Open Net Zero logo
United State Environmental Protection Agency
L o a d i n g

The mission of EPA is to protect human health and the environment. EPA works to ensure that: Americans have clean air, land and water; National efforts to reduce environmental risks are based on the best available scientific information; Federal laws protecting human health and the environment are administered and enforced fairly, effectively and as Congress intended; Environmental stewardship is integral to U.S. policies concerning natural resources, human health, economic growth, energy, transportation, agriculture, industry, and international trade, and these factors are similarly considered in establishing environmental policy; All parts of society--communities, individuals, businesses, and state, local and tribal governments--have access to accurate information sufficient to effectively participate in managing human health and environmental risks; Contaminated lands and toxic sites are cleaned up by potentially responsible parties and revitalized; and Chemicals in the marketplace are reviewed for safety.

Available DatasetsShowing 5458 of 5458 results
    Title
    Updated
  • The raster data represent the amount of wet sulfate deposition in kilograms per hectare from 2014 to 2016. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions, and wet deposition data were interpolated among monitoring stations to generate the map shown.
    1
    4 days ago
  • The raster data represent the amount of wet sulfate deposition in kilograms per hectare from 1989 to 1991. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions, and wet deposition data were interpolated among monitoring stations to generate the map shown.
    1
    4 days ago
  • The raster data represent the amount of wet nitrate deposition in kilograms per hectare from 2014 to 2016. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions, and wet deposition data were interpolated among monitoring stations to generate the map shown.
    1
    4 days ago
  • The raster data represent the amount of wet nitrate deposition in kilograms per hectare from 1989 to 1991. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions, and wet deposition data were interpolated among monitoring stations to generate the map shown.
    1
    4 days ago
  • This dataset identifies the amount of wet, dry, and total deposition of sulfur in kilograms per hectare from 2014 to 2016 at a set of point locations across the contiguous 48 states. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs, based on deposition data from two sources. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/), and dry deposition data are from the Clean Air Status and Trends Network (U.S. EPA, 2018) (https://www.epa.gov/castnet). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions.
    1
    4 days ago
  • This dataset identifies the amount of wet, dry, and total deposition of sulfur in kilograms per hectare from 1989 to 1991 at a set of point locations across the contiguous 48 states. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs, based on deposition data from two sources. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/), and dry deposition data are from the Clean Air Status and Trends Network (U.S. EPA, 2018) (https://www.epa.gov/castnet). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions.
    1
    4 days ago
  • This dataset identifies the amount of wet, dry, and total deposition of nitrogen in kilograms per hectare from 2014 to 2016 at a set of point locations across the contiguous 48 states. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs, based on deposition data from two sources. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/), and dry deposition data are from the Clean Air Status and Trends Network (U.S. EPA, 2018) (https://www.epa.gov/castnet). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions.
    1
    4 days ago
  • This dataset identifies the amount of wet, dry, and total deposition of nitrogen in kilograms per hectare from 1989 to 1991 at a set of point locations across the contiguous 48 states. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs, based on deposition data from two sources. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2018) (http://nadp.slh.wisc.edu/), and dry deposition data are from the Clean Air Status and Trends Network (U.S. EPA, 2018) (https://www.epa.gov/castnet). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions.
    1
    4 days ago
  • This dataset identifies the amount of wet, dry, and total deposition of nitrogen in kilograms per hectare from 1989 to 1991 at a set of point locations across the contiguous 48 states. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs, based on deposition data from two sources. Wet deposition data are from the National Atmospheric Deposition Program/National Trends Network (NADP, 2012) (http://nadp.sws.uiuc.edu/), and dry deposition data are from the Clean Air Status and Trends Network (U.S. EPA, 2012) (http://www.epa.gov/castnet). This indicator aggregates data across 3-year periods to avoid influences from short-term fluctuations in meteorological conditions.
    1
    4 days ago
  • This figure shows how annual average air temperatures have changed in different parts of the United States since the early 20th century (since 1901 for the contiguous 48 states and 1925 for Alaska). The data are shown for climate divisions, as defined by the National Oceanic and Atmospheric Administration.
    1
    4 days ago
  • This polygon dataset shows the outlines of U.S. states. The data were provided by the U.S. Census Bureau.
    1
    4 days ago
  • This map shows cumulative changes in relative sea level from 1960 to 2021 at tide gauge stations along U.S. coasts. Relative sea level reflects changes in sea level as well as land elevation.
    1
    4 days ago
  • The polygon dataset represents predicted indoor radon screening levels in counties across the United States. These data were provided by EPA’s Office of Radiation and Indoor Air as an Excel spreadsheet. In order to produce the Web mapping application, the Excel file was joined with a shapefile of U.S. county boundaries downloaded from the U.S. Census Bureau. Those two sets of data were then converted into a single polygon feature class inside a file geodatabase.
    1
    4 days ago
  • This figure shows the rate of change in total annual precipitation in different parts of the United States since the early 20th century (since 1901 for the contiguous 48 states and 1925 for Alaska). The data are shown for climate divisions, as defined by the National Oceanic and Atmospheric Administration.
    1
    4 days ago
  • This raster dataset comes from the National Land Cover Database (NLCD), 2016 version. It represents land cover across the contiguous 48 states, circa 2016. Each 30-meter-square pixel has been classified using a standard land cover classification scheme, and some of these categories have been aggregated further according to procedures outlined in EPA's Report on the Environment (www.epa.gov/roe). Data were originally processed and compiled by the Multi-Resolution Land Characteristics Consortium (MRLC), a U.S. federal inter-agency group, based on Landsat satellite imagery.
    1
    4 days ago
  • This raster map uses five color-coded categories to show concentrations of dissolved oxygen in bottom waters of Long Island Sound during the summer of 2022. Data were provided by EPA’s Long Island Sound Office and the Connecticut Department of Energy and Environmental Protection.
    1
    4 days ago
  • This point map shows concentrations of dissolved oxygen in bottom waters of Long Island Sound during the summer of 2022. Each point represents a site that was sampled by boat. Data were provided by EPA’s Long Island Sound Office and the Connecticut Department of Energy and Environmental Protection.
    1
    4 days ago
  • This dataset describes dissolved oxygen levels in the Gulf of Mexico. Individual sampling sites are represented by point data. The background polygon shows areas where the dissolved oxygen concentration is less than 2.0 milligrams per liter. The data were collected during the summer of 2021 by the Louisiana Universities Marine Consortium (LUMCON).
    1
    4 days ago
  • This dataset describes dissolved oxygen levels in the Gulf of Mexico. Individual sampling sites are represented by point data. The background polygon shows areas where the dissolved oxygen concentration is less than 2.0 milligrams per liter. The data were collected during the summer of 2021 by the Louisiana Universities Marine Consortium (LUMCON).
    1
    4 days ago
  • Percent reduction is based on the number of native species determined to be present as of 2015, compared with historical numbers documented prior to 1970. Data are displayed by 6-digit hydrologic unit code (HUC-6) watershed. A species is considered "present" if there is at least one record of its presence in any 8-digit HUC within the 6-digit HUC. This indicator presents a summary of data available from the NatureServe Explorer database (https://www.natureserve.org/conservation-tools/data-maps-tools/natureserve-explorer). The identity and status (current vs. historical) of all native fish species recorded in each 8-digit HUC are available from this database, along with species-by-species distribution maps at the 8-digit HUC level. Analyses based on these data have previously been reported in Master et al. (1998, 2003) and Stein et al. (2000). Data were provided by NatureServe.
    1
    4 days ago
  • This web service layer group contains multiple layers at various scale dependencies which enhances the cartographic display of ecoregion data. Each layer depicts ecoregion features drawn at specific scales as detailed in the layer name. IMPORTANT information regarding proper legend rendering in ArcMap: Due to the limitations of Graphical Device Interface (GDI) resources per application on Windows, ArcMap does not display the legend in the Table of Contents for the ArcGIS Server service layer if the legend has more than 100 items. As of December 2011, there are 968 unique legend items in the Level IV Ecoregion Polygon legend. Follow this link (https://support.esri.com/en/knowledgebase/techarticles/detail/33741) for instructions about how to increase the maximum number of ArcGIS Server service layer legend items allowed for display in ArcMap. Note the instructions at this link provide a slightly incorrect path to "Maximum Legend Count". The correct path is HKEY_CURRENT_USER > Software > ESRI > ArcMap > Server > MapServerLayer > Maximum Legend Count. When editing the "Maximum Legend Count", update the field, "Value data" to 1000. To download a PDF version of the Level IV ecoregion map and legend, go to ftp://ftp.epa.gov/wed/ecoregions/us/Eco_Level_IV_US_pg.pdf. Please read the remainder of this layer description for general information about Level IV Omernik Ecoregions. This layer represents Level IV Omernik Ecoregions. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. Compilation of the level IV maps, performed at 1:250,000 scale, has been a part of collaborative projects between US Environmental Protection Agency, National Health and Environmental Effects Laboratory (NHEERL)--Corvallis, OR, the US Forest Service, Natural Resources Conservation Service, and a variety of other state and federal resource agencies. The ecoregions and subregions are designed to serve as a spatial framework for environmental resource management. The most immediate needs by the states are for developing regional biological criteria and water resource standards, and for setting management goals for nonpoint-source pollution. Level IV ecoregions are intended for large geographic extents (i.e. states, multiple counties, or river basins). Use for smaller areas, such as individual counties or a 1:24,000 scale map boundary, is not recommended. Explanation of the methods used to delineate the ecoregions are given in Omernik (1995), Griffith et al. (1994), and Gallant et al. (1989). For more information about Omernik ecoregions or to download ecoregion maps and GIS data, go to: https://www.epa.gov/wed/pages/ecoregions.htm.
    1
    4 days ago
  • The polygon dataset represents areas with acid-sensitive waters in the contiguous United States. Summary data in this indicator were provided by EPA’s Office of Atmospheric Programs and are taken from a publication documenting how surface waters have responded to reduced air emissions of acid rain precursors (U.S. EPA, 2003) and from more recent unpublished results (U.S. EPA, 2014). Trends are based on data collected in two networks: the TIME project and the LTM project. Because both networks are operated by numerous collaborators in state agencies, academic institutions, and other federal agencies, the monitoring data are not available in a single publication or database. The trend data in this indicator are based on observations documented in several publications (see pages 15-17 of U.S. EPA, 2003).
    1
    4 days ago
  • This map shows changes in absolute sea level from 1960 to 2021 based on satellite measurements. Data were adjusted by applying an inverted barometer (air pressure) correction.
    1
    4 days ago
  • Reduction is based on the number of native species determined to be present as of 2015, compared with historical numbers documented prior to 1970. Data are displayed by 6-digit hydrologic unit code (HUC-6) watershed. A species is considered "present" if there is at least one record of its presence in any 8-digit HUC within the 6-digit HUC. This indicator presents a summary of data available from the NatureServe Explorer database (https://www.natureserve.org/conservation-tools/data-maps-tools/natureserve-explorer). The identity and status (current vs. historical) of all native fish species recorded in each 8-digit HUC are available from this database, along with species-by-species distribution maps at the 8-digit HUC level. Analyses based on these data have previously been reported in Master et al. (1998, 2003) and Stein et al. (2000). Data were provided by NatureServe.
    1
    4 days ago
  • NEF hubs were region grouped and then converted to polygons. Analysis was done with the region grouped grid data and then joined to the polygon
    1
    4 days ago
  • These data represent hypoxia sampling locations in the Gulf of Mexico. The data were collected during the summer of 2012 by the Louisiana Universities Marine Consortium (LUMCON).
    0
    4 days ago
  • NEF hubs were region grouped and then converted to polygons. Analysis was done with the region grouped grid data and then joined to the polygon.
    1
    4 days ago
  • NEF corridors were region grouped and then converted to polygons. Analysis was done with the region grouped grid data and then joined to the polygon
    1
    4 days ago
  • The file geodatabase (fgdb) contains the Sea, Lake, and Overland Surge from Hurricanes (SLOSH) Maximum of Maximums (MOM) model for hurricane categories 2 and 4. The EPA Office of Research & Development (ORD) modified the original model from NOAA to fit the model parameters for the Buzzards Bay region. The models show storm surge extent for the Mattapoisett area and therefore the flooding area was reduced to the study area. Areas of flooding that were not connected to the main water body were removed. The files in the geodatabase are: Cat2_SLR0_Int_Feet_dissolve_Mattapoisett: Current Category 2 hurricane with 0 ft sea level rise Cat4_SLR0_Int_Feet_dissolve_Mattapoisett: Current Category 4 hurricane with 0 ft sea level rise Cat4_SLR4_Int_Feet_dissolve_Mattapoisett: Future Category 4 hurricane with 4 feet sea level rise The features support the Weather Ready Mattapoisett story map, which can be accessed via the following link: https://epa.maps.arcgis.com/apps/MapJournal/index.html?appid=1ff4f1d28a254cb689334799d94b74e2
    1
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. Through the Geospatial Data Download Service, the public is now able to download the EPA Geodata shapefile containing facility and site information from EPA's national program systems. The file is Internet accessible from the Envirofacts Web site (https://www.epa.gov/enviro). The data may be used with geospatial mapping applications. (Note: The shapefile omits facilities without latitude/longitude coordinates.) The EPA Geospatial Data contains the name, location (latitude/longitude), and EPA program information about specific facilities and sites. In addition, the file contains a Uniform Resource Locator (URL), which allows mapping applications to present an option to users to access additional EPA data resources on a specific facility or site.
    0
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. Through the Geospatial Data Download Service, the public is now able to download the EPA Geodata shapefile containing facility and site information from EPA's national program systems. The file is Internet accessible from the Envirofacts Web site (https://www.epa.gov/enviro). The data may be used with geospatial mapping applications. (Note: The shapefile omits facilities without latitude/longitude coordinates.) The EPA Geospatial Data contains the name, location (latitude/longitude), and EPA program information about specific facilities and sites. In addition, the file contains a Uniform Resource Locator (URL), which allows mapping applications to present an option to users to access additional EPA data resources on a specific facility or site.
    1
    4 days ago
  • This data layer identifies the locations of Combined sewer overflow outfalls. Combined sewer systems are sewers that are designed to collect rainwater runoff, domestic sewage, and industrial wastewater in the same pipe. Most of the time, combined sewer systems transport all of their wastewater to a sewage treatment plant, where it is treated and then discharged to a water body. During periods of heavy rainfall or snowmelt, however, the wastewater volume in a combined sewer system can exceed the capacity of the sewer system or treatment plant. For this reason, combined sewer systems are designed to overflow occasionally and discharge excess untreated wastewater directly to nearby streams, rivers, or other water bodies. For further information visit: http://cfpub1.epa.gov/npdes/home.cfm?program_id=5
    0
    4 days ago
  • The Expert Query Tool is a web-based reporting tool using the EPA’s WATERS database.There are just three steps to using Expert Query:1. View Selection – Choose what type of information you want from the database.2. Data Element Selection – Choose specific data elements, which will appear as columns in the report, from the database.3. Entering Search Criteria – Refine the data to be displayed and arrange how it will appear in the report.Data can be output from Expert Query in two ways: as HTML (displayed in the user’s web browser) or as a file (comma– or tab-delimited). Files downloaded to the user’s PC can then be imported into a spreadsheet program such as Excel or a database such as Access and manipulated further.
    1
    4 days ago
  • Archive geospatial download files for pre-2015 ATTAINS data, including: Pre-2015 303(d) Listed Impaired Waters Reach Indexed Dataset Archive, Pre-2015 305(b) Waters As Assessed Reach Indexed Dataset Archive, 2002 Impaired Waters Baseline Reach Indexed Dataset Archive, Watershed Boundaries for the 2002 Impaired Waters Baseline, and Pre-2015 Impaired Waters with TMDLs Reach Indexed Dataset Archive. The Total Maximum Daily Load (TMDL) Tracking System contained information on waters that are Not Supporting their designated uses. These waters were listed by the state as impaired under Section 303(d) of the Clean Water Act. The status of TMDLs were also tracked. TMDLs are pollution control measures that reduce the discharge of pollutants into impaired waters. A TMDL or Total Maximum Daily Load is a calculation of the maximum amount of a pollutant that a waterbody can receive and still meet water quality standards, and an allocation of that amount to the pollutant's sources. Under Section 305(b) of the CWA, the states, territories, and other jurisdictions of the United States are required to submit reports on the quality of their waters to the U.S. Environmental Protection Agency (EPA) every 2 years.
    1
    4 days ago
  • The NEPmap is designed to provide information in context with National Estuary Program Study Areas. There are 28 National Estuary Programs (NEPs) in the U.S.that implement habitat protection and restoration projects with their partners and submit their project data to the EPA annually. NEPmap contains that project data from 2009 to the present.
    1
    4 days ago
  • There are 28 National Estuary Programs (NEPs) in the U.S.that implement habitat protection and restoration projects with their partners. This work takes place within their study area boundaries. NEPmap contains that data from 2009 to the present.
    1
    4 days ago
  • Information on sole source aquifers (SSAs) is widely used in assessments under the National Environmental Policy Act and at the state and local level. A national layer, including all available SSA coverages, is available for use in GIS. This layer includes the GIS polygons for SSAs. In addition to single SSA designated area polygons, some EPA regional offices have delineated GIS layers for: * Streamflow zones * Aquifer recharge areas * Other features at the land surface important for SSA designations. The SSA geospatial data set is available through Data.gov for use by government agencies, private organizations, and the public.
    1
    4 days ago
  • The Drinking Water Mapping Application (DWMA) is a web-based geographic information system (GIS) that enhances the capabilities to identify major contaminant risks to public drinking water supplies. The DWMA includes functionality for both surface and ground-water based public water systems, including a well visualization tool (under development), non-point source and non-NHD data layer analyses, and multi-program analyses.
    1
    4 days ago
  • This dataset contains twelve-digit hydrologic subwatershed units aggregated from the NHDPlus v21+AK Beta State Catchment Fabric. These units express the Catchment Crosswalk logic used to assign NHDPlus catchments to HUC12 units and are not representative of the Watershed Boundary Dataset or other hydrologic unit systems.
    0
    4 days ago
  • This dataset contains upstream watershed drainage areas for catchments comprising Catchment Fabric HUC12 units. The dataset is incomplete for Alaska.
    0
    4 days ago
  • The Beaches Environmental Assessment and Coastal Health (BEACH) Program focuses on the following five areas to meet the goals of improving public health and environmental protection for beach goers and providing the public with information about the quality of their beach water: strengthening beach standards and testing, providing faster laboratory test methods-predicting pollution, investing in health and methods research, informing the public. Under the BEACH Act Grant Program states (including tribes and territories) are required to submit their beach monitoring (water quality), notification (advisory and closing), and beach location data to EPA.
    1
    4 days ago
  • The Beaches Environmental Assessment and Coastal Health (BEACH) Program focuses on the following five areas to meet the goals of improving public health and environmental protection for beach goers and providing the public with information about the quality of their beach water: strengthening beach standards and testing, providing faster laboratory test methods-predicting pollution, investing in health and methods research, informing the public. Under the BEACH Act Grant Program states (including tribes and territories) are required to submit their beach monitoring (water quality), notification (advisory and closing), and beach location data to EPA.
    1
    4 days ago
  • State water quality assessment decisions reported to EPA under the Integrated Report (IR), and Clean Water Act Sections 303(d) and 305(b). This service provides summary information for each Assessment Unit. For more detailed data, please reference the Assessment Total Maximum Daily Load (TMDL) Tracking and Implementation System (ATTAINS) web services. Information on those web services is provided on the public ATTAINS website: https://www.epa.gov/waterdata/attains
    0
    4 days ago
  • Private domestic well use estimates for US Census block groups were calculated using a combination of population and housing unit data from the 1990, 2000 and 2010 Decennial Censuses in conjunction with available state level domestic well completion reports for domestic wells constructed between April 1, 1990 and March 31, 2010. A detailed description of how this data was created can be found in Weaver et. al (2017).
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2005). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103.Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. Comments and questions regarding the Level III and IV Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2005). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2013. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding the Level III and IV Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    0
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for EPA Administrative Regions were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for EPA Administrative Regions were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for EPA Administrative Regions were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for EPA Administrative Regions were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for the Mississippi Alluvial Plain were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. By recognizing the spatial differences in the capacities and potentials of ecosystems, ecoregions stratify the environment by its probable response to disturbance (Bryce and others, 1999). These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and non-government organizations that are responsible for different types of resources within the same geographical areas (Omernik and others, 2000). The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of the spatial patterns and the composition of biotic and abiotic phenomena that affect or reflect differences in ecosystem quality and integrity (Wiken, 1986; Omernik, 1987, 1995). These phenomena include geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another regardless of the hierarchical level. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). This product is part of a collaborative effort primarily between USEPA Region VII, USEPA National Health and Environmental Effects Research Laboratory (Corvallis, Oregon), Mississippi Department of Environmental Quality, Arkansas Department of Environmental Quality, Arkansas Multi-Agency Wetland Planning Team (MAWPT), U.S. Army Corps of Engineers (USACE), U.S. Department of Agriculture (USDA) - Natural Resources Conservation Service (NRCS), U.S. Department of Interior - Fish and Wildlife Service (USFWS), and U.S. Department of Interior - U.S. Geological Survey (USGS) - Earth Resources Observation Systems (EROS) Data Center. The project is associated with an interagency effort to develop a common framework of ecological regions. Reaching that objective requires recognition of the differences in the conceptual approaches and mapping methodologies that have been used to develop the most common ecoregion-type frameworks, including those developed by the U.S. Department of Agriculture - Forest Service (USFS) (Bailey and others, 1994), the USEPA (Omernik, 1987, 1995), and the NRCS (United States Department of Agriculture - Soil Conservation Service, 1981). As each of these frameworks is further refined, their differences are becoming less discernible. Regional collaborative projects such as this one in the Mississippi Alluvial Plain, where agreement can be reached among multiple resource management agencies, are a step toward attaining consensus and consistency in ecoregion frameworks for the entire nation. Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions for the Mississippi Alluvial Plain were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. By recognizing the spatial differences in the capacities and potentials of ecosystems, ecoregions stratify the environment by its probable response to disturbance (Bryce and others, 1999). These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and non-government organizations that are responsible for different types of resources within the same geographical areas (Omernik and others, 2000). The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of the spatial patterns and the composition of biotic and abiotic phenomena that affect or reflect differences in ecosystem quality and integrity (Wiken, 1986; Omernik, 1987, 1995). These phenomena include geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another regardless of the hierarchical level. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). This product is part of a collaborative effort primarily between USEPA Region VII, USEPA National Health and Environmental Effects Research Laboratory (Corvallis, Oregon), Mississippi Department of Environmental Quality, Arkansas Department of Environmental Quality, Arkansas Multi-Agency Wetland Planning Team (MAWPT), U.S. Army Corps of Engineers (USACE), U.S. Department of Agriculture (USDA) - Natural Resources Conservation Service (NRCS), U.S. Department of Interior - Fish and Wildlife Service (USFWS), and U.S. Department of Interior - U.S. Geological Survey (USGS) - Earth Resources Observation Systems (EROS) Data Center. The project is associated with an interagency effort to develop a common framework of ecological regions. Reaching that objective requires recognition of the differences in the conceptual approaches and mapping methodologies that have been used to develop the most common ecoregion-type frameworks, including those developed by the U.S. Department of Agriculture - Forest Service (USFS) (Bailey and others, 1994), the USEPA (Omernik, 1987, 1995), and the NRCS (United States Department of Agriculture - Soil Conservation Service, 1981). As each of these frameworks is further refined, their differences are becoming less discernible. Regional collaborative projects such as this one in the Mississippi Alluvial Plain, where agreement can be reached among multiple resource management agencies, are a step toward attaining consensus and consistency in ecoregion frameworks for the entire nation. Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions by state were extracted from the seamless national shapefile. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 105 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2011). Level IV ecoregions are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A. L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. U.S. Environmental Protection Agency. 2011. Level III and IV ecoregions of the continental United States. U.S. EPA, National Health and Environmental Effects Research Laboratory, Corvallis, Oregon, Map scale 1:3,000,000. Available online at: https://www.epa.gov/eco-research/level-iii-and-iv-ecoregions-continental-united-states. Comments and questions regarding Ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. The ecoregions of Alaska are a framework for organizing and interpreting environmental data for State, national, and international level inventory, monitoring, and research efforts. The map and descriptions for 20 ecological regions were derived by synthesizing information on the geographic distribution of environmental factors such as climate, physiography, geology, permafrost, soils, and vegetation. A qualitative assessment was used to interpret the distributional patterns and relative importance of these factors from place to place (Gallant and others, 1995). Numeric identifiers assigned to the ecoregions are coordinated with those used on the map of "Ecoregions of the Conterminous United States" (Omernik 1987, U.S. EPA 2010) as a continuation of efforts to map ecoregions for the United States. Additionally, the ecoregions for Alaska and the conterminous United States, along with ecological regions for Canada (Wiken 1986) and Mexico, have been combined for maps at three hierarchical levels for North America (Omernik 1995, Commission for Environmental Cooperation, 1997, 2006). A Roman numeral hierarchical scheme has been adopted for different levels of ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 50 regions. At Level III, there are currently 182 ecological regions for North America. Level IV ecoregions have been developed for the conterminous United States, but Level III is the highest level available for Alaska. Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America - toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Commission for Environmental Cooperation, 2006, Ecological regions of North America, Level III, Map scale 1:10,000,000, https://www.epa.gov/eco-research/ecoregions-north-america. Gallant, A.L., Binnian, E.F. Omernik, J.M. and Shasby, M.B., 1995, Ecoregions of Alaska: U.S. Geological Survey Professional Paper 1567. Omernik, J.M., 1987, Ecoregions of the Conterminous United States: Annals of the Association of American Geographers, v. 77, no.1, p. 118-125. Omernik, J.M., 1995, Ecoregions: a Framework for Managing Ecosystems: The George Wright Forum, v. 12, no. 1, p. 35-51. U.S. Environmental Protection Agency, 2010, Level III ecoregions of the continental United States (revision of Omernik, 1987): Corvallis, Oregon, USEPA - National Health and Environmental Effects Research Laboratory, Map M-1, various scales. Wiken, E.B., 1986, Terrestrial Ecozones of Canada: Lands Directorate, Environmental Canada Ecological Land Classification Series 19, 26 p. Comments and questions regarding ecoregions should be addressed to Glenn Griffith, USGS, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, (541)-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • The Human Well-being Index (HWBI) for U.S. counties is a set of nationally consistent demonstration results that may be used to characterize community well-being. This composite index was developed by U.S. EPA Office of Research and Development in support of its Sustainable and Healthy Communities (SHC) Research. It serves as an endpoint measure for use in the creation of community decision-support tools. The HWBI characterizes community conditions in the context of the flow of economic, social and ecological services. The index calculation approach used a nested-indicator design. A decade (2000-2010) of cultural, economic, and social data were drawn from publicly available sources (e.g., US Census, Bureau of Economic Analysis, American Community Survey, General Social Survey, Centers for Disease Control) to provide the foundation for well-being related indicators. Indicators are integrated into one of eight domains or sub-indices of well-being. These domains were synthesized to represent different aspects of well-being characteristics common across communities of all sizes. Service indicators reflect the availability of select socio-ecological services that influence well-being. Community decisions often result in changes in the flow of community services. Collectively, well-being and service measures provide a means to evaluate relationships between the availability of certain community services and overall well-being. Data used to generate service indicators were also collected from existing data sources. Detailed information about the attributes of the HWBI, its components and related service indicators are described in Indicators and Methods for Constructing a U.S. Human Well-being Index (HWBI) for Ecosystem Services Research (EPA/600/R-12/023. pp. 121) and Indicators and Methods for Evaluating Economic, Ecosystem and Social Services Provisioning (EPA/600/R-14/184. pp. 174), respectively.
    1
    4 days ago
  • Climate and land-use change are major components of global environmental change with feedbacks between these components. The consequences of these interactions show that land use may exacerbate or alleviate climate change effects. Based on these findings it is important to use land-use scenarios that are consistent with the specific assumptions underlying climate-change scenarios. The Integrated Climate and Land-Use Scenarios (ICLUS) project developed land-use outputs that are based on a downscaled version of the Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) social, economic, and demographic storylines. ICLUS outputs are derived from a pair of models. A demographic model generates county-level population estimates that are distributed by a spatial allocation model (SERGoM v3) as housing density across the landscape. Land-use outputs were developed for the four main SRES storylines and a baseline ("base case"). The model is run for the conterminous USA and output is semi-decadally for each scenario to 2100. In addition to housing density at a 1 hectare spatial resolution, this project also generated estimates of impervious surface at a resolution of 1 square kilometer.
    0
    4 days ago
  • Climate and land-use change are major components of global environmental change with feedbacks between these components. The consequences of these interactions show that land use may exacerbate or alleviate climate change effects. Based on these findings it is important to use land-use scenarios that are consistent with the specific assumptions underlying climate-change scenarios. The Integrated Climate and Land-Use Scenarios (ICLUS) project developed land-use outputs that are based on a downscaled version of the Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) social, economic, and demographic storylines. ICLUS outputs are derived from a pair of models. A demographic model generates county-level population estimates that are distributed by a spatial allocation model (SERGoM v3) as housing density across the landscape. Land-use outputs were developed for the four main SRES storylines and a baseline ("base case"). The model is run for the conterminous USA and output is available for each scenario by decade to 2100. In addition to housing density at a 1 hectare spatial resolution, this project also generated estimates of impervious surface at a resolution of 1 square kilometer. This shapefile holds population data for all counties of the conterminous USA for all decades (2010-2100) and SRES population growth scenarios (A1, A2, B1, B2), as well as a 'base case' (BC) scenario, for use in the Integrated Climate and Land Use Scenarios (ICLUS) project.
    1
    4 days ago
  • Climate and land-use change are major components of global environmental change with feedbacks between these components. The consequences of these interactions show that land use may exacerbate or alleviate climate change effects. Based on these findings it is important to use land-use scenarios that are consistent with the specific assumptions underlying climate-change scenarios. The Integrated Climate and Land-Use Scenarios (ICLUS) project developed land-use outputs that are based on a downscaled version of the Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) social, economic, and demographic storylines. ICLUS outputs are derived from a pair of models. A demographic model generates county-level population estimates that are distributed by a spatial allocation model (SERGoM v3) as housing density across the landscape. Land-use outputs were developed for the four main SRES storylines and a baseline ("base case"). The model is run for the conterminous USA and output is semi-decadally for each scenario to 2100. In addition to housing density at a 1 hectare spatial resolution, this project also generated estimates of impervious surface at a resolution of 1 square kilometer.
    1
    4 days ago
  • Climate and land-use change are major components of global environmental change with feedbacks between these components. The consequences of these interactions show that land use may exacerbate or alleviate climate change effects. Based on these findings it is important to use land-use scenarios that are consistent with the specific assumptions underlying climate-change scenarios. The Integrated Climate and Land-Use Scenarios (ICLUS) project developed land-use outputs that are based on a downscaled version of the Intergovernmental Panel on Climate Change (IPCC) Special Report on Emissions Scenarios (SRES) social, economic, and demographic storylines. ICLUS outputs are derived from a pair of models. A demographic model generates county-level population estimates that are distributed by a spatial allocation model (SERGoM v3) as housing density across the landscape. Land-use outputs were developed for the four main SRES storylines and a baseline ("base case"). The model is run for the conterminous USA and output is available for each scenario by decade to 2100. In addition to housing density at a 1 hectare spatial resolution, this project also generated estimates of impervious surface at a resolution of 1 square kilometer.
    1
    4 days ago
  • ToxCast is used as a cost-effective approach for efficiently prioritizing the toxicity testing of thousands of chemicals. It uses data from state-of-the-art high throughput screening (HTS) bioassay and builds computational models to forecast potential chemical toxicity in humans. ToxRefDB stores data related to ToxCast.
    0
    4 days ago
  • The Polychlorinated Biphenyls (PCB) Transformer Registration Database tracks geographic and dated information of registered PCB transformers.
    0
    4 days ago
  • HERO contains the key studies EPA uses to develop environmental risk assessments for the public. EPA uses risk assessments to characterize the nature and magnitude of health risks to humans and the ecosystem from pollutants and chemicals in the environment.
    0
    4 days ago
  • The Ecotoxicology Database (ECOTOX) provides information on effects of single chemicals to ecologically-relevant species.
    0
    4 days ago
  • The Distributed Structure-Searchable Toxicity (DSSTox) Database Network provides a public forum for search and publishing downloadable, structure-searchable, standardized chemical structure files associated with toxicity data.
    1
    4 days ago
  • The Biota-Sediment Accumulation Factor contains approximately 20,000 biota-sediment accumulation factors (BSAFs) from 20 locations (mostly Superfund sites) for nonionic organic chemicals and pesticides. Fresh, tidal, and marine ecosystems are included in the data.
    0
    4 days ago
  • Subtitle I of the Resource Conservation and Recovery Act, as amended by the Hazardous Waste Disposal Act of 1984, brought underground storage tanks (USTs) under federal regulation. As part of that regulation, Congress directed EPA to develop financial responsibility regulations for UST owners and operators. Congress wanted owners and operators of underground storage tanks (USTs) to show that they have the financial resources to clean up a site if a release occurs, correct environmental damage, and compensate third parties for injury to their property or themselves. Owners and operators have several options: obtain insurance coverage from an insurer or a risk retention group; demonstrate self-insurance using a financial test; obtain corporate guarantees, surety bonds, or letters of credit; place the required amount into a trust fund administered by a third party; or rely on coverage provided by a state financial assurance fund. Information in this data asset includes state documentation to support this requirement. Many states have developed financial assurance funds to help owners and operators meet financial responsibility requirements and to help cover the costs of cleanups. State financial assurance fund programs, which supplement or are a substitute for private insurance, have been especially useful for small-to-medium sized petroleum marketers. EPA requires its Regional Offices to conduct annual reviews of state financial assurance funds. Data is provided by states, and reviewed by EPA, to determine financial soundness as follows: 1. How quickly each state's fund is reducing its federally-regulated, fund-eligible cleanup backlog. 2. Whether the fund currently has enough resources to address its backlog. 3. Whether the fund will continue to have adequate resources to continue to reduce its backlog in the future. 4. Whether there are any major or pending changes to the fund. EPA has the option of withdrawing fund approval, in which case the Agency works with the state to ensure that UST owners and operators have obtained an alternative financial responsibility mechanism. All documentation for these reviews, and subsequent decisions and actions, are maintained at the Regional Offices.
    0
    4 days ago
  • This asset contains all Underground Storage Tank (UST) site information. It includes details such as property location, acreage, identification and characterization, and site assessments (current and historical) and characterization. This information is collected and held at the state/territory level. Regulatory authority for the collection of this information is found in Subtitle I of the Resource Conservation and Recovery Act (RCRA), as amended by the Hazardous Waste Disposal Act of 1984, which brought underground storage tanks (USTs) under federal regulation.
    1
    4 days ago
  • This asset includes an inventory of programmatic information, including policies and guidance, training course materials and Leaking Underground Storage Tanks (LUST) Trust Fund information. This documentation is used by states, territories, tribes and private parties to implement the Underground Storage Tank (UST) program. It also includes analysis of the laws and regulations that govern USTs, and policies and guidance for implementing the UST program developed by EPA in consultation with state and territorial UST programs.
    1
    4 days ago
  • Subtitle I of the Resource Conservation and Recovery Act, as amended by the Hazardous Waste Disposal Act of 1984, brought underground storage tanks (USTs) under federal regulation. EPA implements the underground storage tank (UST) program in Indian country, providing support to tribal governments to prevent and clean up petroleum releases from USTs. The UST program in Indian country includes marketers and nonretail facilities that have USTs. Marketers include retail facilities such as gas stations and convenience stores that sell petroleum products. Non-retail facilities include those that do not sell petroleum products, but may rely on their own supply of gasoline or diesel for taxis, buses, limousines, trucks, vans, boats, heavy equipment, or a wide range of other vehicles. Of the more than 560 federally recognized tribes about 200 have federally-regulated underground storage tanks on their lands. Of those 200 tribes, over half have 10 or fewer active underground storage tanks. About 20 tribes have 30 or more underground storage tanks. Data on sites managed by this program is assembled by the EPA Regional Offices and varies from region to region in scope and content. Not all regions include Indian Nations. Publicly available data is limited to Excel spreadsheets, but regional contacts are also available to answer questions about the data. Data is updated in May and November of each year.
    1
    4 days ago
  • This asset includes a collection of information resources, training, and other media related to hazardous waste site cleanup and characterization. A major part of this asset is the CLU-IN System, which is a collection of websites designed to be the central reference library for ""the development, collection, evaluation, coordination, and dissemination of information relating to the utilization of alternative or innovative treatment technologies..."" for cleaning up hazardous waste sites (Title 42 Section 9660 (b)(8)). Information includes Best Practices for using innovative technologies, case studies and focus areas about characterization and remediation technologies, emerging issues, optimization, and green(ing) remediation. CLU-IN is available via web-based documentation, live events, podcasts, and videos. Additionally, the Technology Innovation and Field Services Division (TIFSD) supports both classroom and online training registration through Trainex.org. All EPA content is also posted on EPA's website.
    0
    4 days ago
  • This asset includes data related to the Superfund Technical Assistance Grant program, including grant number, award amounts, award dates, period of performance, site/PRP name, and community group awarded grant. Data collected from Regional TAG Coordinators enables HQ to easily access statistical information on the TAG program in order to respond to requests for Catalog of Federal Domestic Assistance (CFDA) updates, requests for talking point information, questions from OSRTI/OSWER managers, and other various requests for program statistics.
    0
    4 days ago
  • This asset includes Superfund site-specific sampling information including location of samples, types of samples, and analytical chemistry characteristics of samples. Information is associated with a particular contaminated sate as there is no national database of this information.
    0
    4 days ago
  • This asset includes a number of individual data sets related to site-specific information for Superfund, which is governed under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980, which was amended by the Superfund Amendments and Reauthorization Act (SARA) in 1986. The Superfund Enterprise Management System (SEMS) contains basic site description, location, schedule of activities, enforcement and settlement data, contaminants and selected remedy and much more, as well as the records that clearly document site decisions. This asset also includes sampling data and lab results (CLPSS, EDDs), redevelopment and technical assistance case studies, site reuse and land revitalization information, EPAOSC.net information, Superfund Technical Assistance Grants information, site management information records (RODs, Remediation plans, cleanup directives), contract management information, and more. Superfund site management information can also be found in agency wide systems such as EAS and COMPASS.
    1
    4 days ago
  • This asset includes an inventory of program policy and guidance documents that are used by the EPA regions, states, tribes and private parties to implement the Superfund program. This collection of documents currently exists in two primary places - the Superfund Enterprise Management System (SEMS) and on the Superfund public website. Eventually all of the documents will be placed in SEMS, which is the official recordkeeping system of the program. This asset also includes contract management information relevant to non-site-specific OSRTI contracts.
    0
    4 days ago
  • The Unit Cost Compendium (UCC) Calculations raw data set was designed to provide for greater accuracy and consistency in the use of unit costs across the USEPA Office of Resource Conservation and Recovery (ORCR), as well as increased accessibility to unit costs inside and outside the ORCR.
    0
    4 days ago
  • The State Authorization Tracking System (StATS) is an information management system designed to document the progress of each state and territory in establishing and maintaining RCRA-authorized hazardous waste management programs. StATS tracks the status of each state with regard to changes made to the federal hazardous waste regulations. The pages listed at the website show state authorization and adoption information for RCRA Subtitle C hazardous waste rules. Adoption information is based on data received from EPA regional offices. Currently, state authorization and adoption percentages are based on the required rules promulgated through RCRA Cluster XXII. Published federal register notices are the only legal mechanism by which EPA grants authorization to the states. If any of the information contained in the StATS database conflicts with information stated in the Federal Register, the Federal Register information will take precedence. We strongly recommend that the regulated community contact their state government office for hazardous waste regulatory information.
    1
    4 days ago
  • The Resource Conservation and Recovery Act Information (RCRAInfo) system contains information reported to the state environmental programs on activities and cleanup from hazardous waste generators, transporters, treaters, storers and disposers of hazardous waste.
    0
    4 days ago
  • This asset includes a broad variety of documents, descriptive data, technical analyses and guidance materials relative to voluntary improvements in resource conservation, the beneficial use of sustainable materials and the management of non-hazardous wastes and materials. Included in this asset are participant information and outreach materials of various voluntary programs relating to better materials and waste management programs. An example is the WasteWise program and Sustainable Materials Management (SMM) Challenges, which help organizations and businesses apply sustainable materials management practices to reduce municipal and select industrial wastes. Also included in this asset are guidance materials to assist municipalities in recycling and reuse of municipal solid waste, including diverting materials to composting, and the use of conversion methods such as anaerobic digestion. Another component are the data necessary to compile reports on the characterization of municipal solid waste (including such waste streams as food waste, yard and wood waste, discarded electronics, and household non-hazardous waste), the recycled content of manufactured goods, and other analyses performed using such tools as the Waste Assessment Reduction Model (WARM). For industrial non-hazardous waste, this asset includes guidance and outreach materials on industrial materials recycling and waste minimization. Finally, this asset includes research analyses on sustainable materials management conducted in collaboration with the EPA Office of Research Development, including results of the Life Cycle Assessment (LCA) input-output model.
    0
    4 days ago
  • This asset includes program policy and guidance documents that are used by the EPA regions, states, tribes and private parties to implement the hazardous waste management program under the Resource Conservation and Recovery Act (RCRA). This asset does not contain facility-specific information (see RCRA Facility Information data asset). In addition to policy and guidance, included here are training materials, economic analysis, public information, and program performance and other management level data that feeds into the Performance Assessment Tool (see separate data asset). Much of the information in this asset is available through RCRA Online. The RCRA Online database is designed to enable users to locate documents, including publications and other outreach materials, that cover a wide range of RCRA issues and topics.
    0
    4 days ago
  • This asset includes hazardous waste information, which is mostly contained in the Resource Conservation and Recovery Act Information (RCRAInfo) System, a national program management and inventory system addressing hazardous waste handlers. In general, all entities that generate, transport, treat, store, and dispose of hazardous waste are required to provide information about their activities to state environmental agencies. These agencies pass on that information to regional and national EPA offices. This regulation is governed by the Resource Conservation and Recovery Act (RCRA), as amended by the Hazardous and Solid Waste Amendments of 1984. RCRAInfo Search can be used to determine identification and location data for specific hazardous waste handlers and to find a wide range of information on treatment, storage, and disposal facilities regarding permit/closure status, compliance with Federal and State regulations, and cleanup activities. Categories of information in this asset include: -- Handlers -- Permit Information -- GIS information on facility location -- Financial Assurance -- Corrective Action -- Compliance Monitoring and Enforcement (CM&E)
    0
    4 days ago
  • The United States Environmental Protection Agency (EPA), in cooperation with the States, biennially collects information regarding the generation, management, and final disposition of hazardous wastes regulated under the Resource Conservation and Recovery Act of 1976 (RCRA), as amended. Collection, validation and verification of the Biennial Report (BR) data is the responsibility of RCRA authorized states and EPA regions. EPA does not modify the data reported by the states or regions. Any questions regarding the information reported for a RCRA handler should be directed to the state agency or region responsible for the BR data collection. BR data are collected every other year (odd-numbered years) and submitted in the following year. The BR data are used to support regulatory activities and provide basic statistics and trend of hazardous waste generation and management. BR data is available to the public through 3 mechanisms. 1. The RCRAInfo website includes data collected from 2001 to present-day (https://rcrainfo.epa.gov/rcrainfoweb/action/main-menu/view). Users of the RCRAInfo website can run queries and output reports for different data collection years at this site. All BR data collected from 2001 to present-day is stored in RCRAInfo, and is accessible through this website. 2. BR data files collected from 1999 - present day may be downloaded directory in zip file format from (https://rcrapublic.epa.gov/rcra-public-export/?outputType=Fixed or https://rcrapublic.epa.gov/rcra-public-export/?outputType=CSV). 3. Historical data collected prior to 1999 may be ordered on CD. Please see contact information in this metadata file to order historical BR data. BR data are typically published in December of the year following their collection. Data must be received by authorized states and EPA regions if a state is not authorized to implement the BR program by March 1st of the year following collection, and are usually published in December of the year following collection. For example, data collected in 2001 would be received by states and EPA regions by March 1, 2002 and states and EPA regions compile the BR data submitted by facilities and load the state data set into RCRAInfo, the system which EPA Headquarters (HQ) manage. Then EPA HQ published the data files around December 2002. Additional information regarding the biennial report data is available here: https://rcrapublic.epa.gov/rcra-public-export/rcrainfo_flat_file_documentation_v5.pdf and here: https://www.epa.gov/hwgenerators/biennial-hazardous-waste-report. Please note that the update frequency field for this data set indicates annual, but that the true update period is biennial (every other year). There is no selection option for biennial for the update frequency field.
    1
    4 days ago
  • EPA's Comprehensive Procurement Guideline (CPG) designates recycled content products that government agencies should buy. EPA publishes purchasing guidance and recommendations for recycled content levels in Recovered Material Advisory Notices (RMANs) that accompany each CPG, and updates its guidance annually. For the convenience of procurement officials, this document represents a compilation of the five RMANs published by EPA to date.
    0
    4 days ago
  • This GIS dataset contains polygons depicting RCRA Corrective Action boundary features from all EPA Regions. The Resource Conservation and Recovery Act (RCRA), among other things, helps ensure that wastes are managed in an environmentally sound manner so as to protect human health and the environment from the potential hazards of waste disposal. EPA and 44 authorized states and territories run the Resource Conservation and Recovery Act (RCRA) Corrective Action program to work with hazardous waste facilities to investigate and clean up any release of hazardous waste into the soil, ground water, surface water and air. In general, all generators, transporters, treaters, storers, and disposers of hazardous waste are required to provide information about their activities to state environmental agencies. These agencies, in turn pass on the information to regional and national EPA offices. Accidents or other activities at facilities that treat, store or dispose of hazardous wastes have sometimes led to the release of hazardous waste or hazardous constituents into soil, ground water, surface water, or air. When that happens, the RCRA Corrective Action program is one program that may be used to accomplish the necessary cleanup. This data set provides boundaries for those areas where cleanup activities are underway. RCRA CABs and cleanup boundaries are meant to include the various boundaries associated with a site, including: institutional controls, engineering controls, land use controls, anticipated/acceptable use limitations, operable units, as well as the site or facility boundaries.
    0
    4 days ago
  • This data layer provides access to Recovery Act Funded Cleanup sites as part of the CIMC web service. The American Recovery and Reinvestment Act was signed into law by President Obama on February 17th, 2009 and all reporting on ARRA for these 3 programs was complete as of 2013. Out of the five EPA programs that distributed recovery act funding, three of them were cleanup programs: Brownfields, Superfund and Leaking Underground Storage Tanks. CIMC provides information on site cleanups that received ARRA Recovery Act funding for Superfund and Brownfields, but not Leaking Underground Storage Tanks. Data for Brownfields came from the ACRES database. Data for Superfund came from the Comprehensive Environmental Response, Compensation, and Liability Information System (CERCLIS) database. Data in CIMC no longer need to be updated for the ARRA program. For information on all EPA Recovery Act funded work, please see: http://archive.epa.gov/recovery/web/html/ and https://epamap17.epa.gov/arra/.
    1
    4 days ago
  • This data layer provides access to Removal/Response sites as part of the CIMC web service. Removals are hazardous substance releases that require immediate or short-term response actions. These are generally addressed under the Emergency Response program and are initially tracked centrally by the federal government's National Reporting Center. Cleanups in My Community maps and lists removals that are included in EPA’s epaosc.org site, and provides direct links to information on these sites. CIMC obtains updated removal data through a web service from epaosc.org twice a month. The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Hazardous Waste Corrective Action sites as part of the CIMC web service. Hazardous waste is waste that is dangerous or potentially harmful to our health or the environment. Hazardous wastes can be liquids, solids, gases, or sludges. They can be discarded commercial products, like cleaning fluids or pesticides, or the by-products of manufacturing processes. The RCRA Corrective Action Program, run by EPA and 43 authorized states and territories, works with facilities that have treated, stored, or disposed of hazardous wastes (TSDs) to protect public health and the environment by investigating and cleaning up hazardous releases to soil, ground water, surface water, and air at their facilities. RCRA Corrective Action sites in all 50 states and four U.S. territories cover 18 million acres of land. EPA estimates that more than 35 million people, roughly 12 percent of the U.S. population, live within one mile of a RCRA Corrective Action site (based on the 2000 U.S. Census). RCRA Corrective Action facilities include many current and former chemical manufacturing plants, oil refineries, lead smelters, wood preservers, steel mills, commercial landfills, and a variety of other types of entities. Due to poor practices prior to environmental regulations, Corrective Action facilities have left large stretches of river sediments laden with PCBs; deposited lead in residential yards and parks beyond site boundaries; polluted drinking water wells in rural areas with chlorinated solvents; tainted municipal water supplies used by millions; and introduced mercury into waterways, necessitating fish advisories. At these sites, the Corrective Action Program ensures that cleanups occur. EPA and state regulators work with facilities and communities to design remedies based on the contamination, geology, and anticipated use unique to each site. Note: RCRA facilities which are not undergoing corrective action are not considered “Cleanups” in Cleanups in My Community. The complete set of RCRA facilities can be accessed via the EPA RCRA database in Envirofacts (https://www.epa.gov/enviro/rcrainfo-overview). The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • Federal facilities are properties owned by the federal government. This data layer provides access to Federal facilities that are Resource Conservation and Recovery Act (RCRA) sites as part of the CIMC web service. The Resource Conservation and Recovery Act, among other things, helps ensure that wastes are managed in an environmentally sound manner so as to protect human health and the environment from the potential hazards of waste disposal. In particular, RCRA tightly regulates all hazardous waste from "cradle to grave." In general, all generators, transporters, treaters, storers, and disposers of hazardous waste are required to provide information about their activities to state environmental agencies. These agencies, in turn pass on the information to regional and national EPA offices. Accidents or other activities at facilities that treat, store or dispose of hazardous wastes have sometimes led to the release of hazardous waste or hazardous constituents into soil, ground water, surface water, or air. When that happens, the RCRA Corrective Action program is one program that may be used to accomplish the necessary cleanup. In Cleanups in My Community, you can map or list RCRA Corrective Action sites that are currently undergoing corrective action, sites for which a remedy has been selected, sites for which construction has been completed, and sites where the corrective action cleanup is complete. This data layer shows those RCRA sites that are located at Federal Facilities. Note: RCRA facilities which are not undergoing corrective action are not considered “Cleanups” in Cleanups in My Community. The complete set of RCRA facilities can be accessed via the EPA RCRA database in Envirofacts (https://enviro.epa.gov/facts/rcrainfo/search.html). The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Resource Conservation and Recovery Act (RCRA) Base Realignment and Closure (BRAC) sites as part of the CIMC web service. The Resource Conservation and Recovery Act, among other things, helps ensure that wastes are managed in an environmentally sound manner so as to protect human health and the environment from the potential hazards of waste disposal. In particular RCRA tightly regulates all hazardous waste from "cradle to grave." In general, all generators, transporters, treaters, storers, and disposers of hazardous waste are required to provide information about their activities to state environmental agencies. These agencies, in turn pass on the information to regional and national EPA offices. Accidents or other activities at facilities that treat, store or dispose of hazardous wastes have sometimes led to the release of hazardous waste or hazardous constituents into soil, ground water, surface water, or air. When that happens, the RCRA Corrective Action program is one program that may be used to accomplish the necessary cleanup. This data layer shows those RCRA sites that are located at BRAC Federal Facilities. Additional RCRA sites and other BRAC sites (those that are not RCRA sites) are included in other data layers as part of this web service. Note: RCRA facilities which are not undergoing corrective action are not considered “Cleanups” in Cleanups in My Community. The complete set of RCRA facilities can be accessed via the EPA RCRA database in Envirofacts (https://www.epa.gov/enviro/rcrainfo-overview). The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Brownfields Properties as part of the CIMC web service, although the data are generally more broadly applicable. Brownfields are real properties, the expansion, redevelopment, or reuse of which may be complicated by the presence or potential presence of a hazardous substance, pollutant, or contaminant. Cleaning up and reinvesting in these properties takes development pressures off of undeveloped, open land, and both improves and protects the environment. CIMC provides information on Brownfields properties for which information is reported back to EPA, as well as areas served by Brownfields grants programs. Brownfields properties may be mapped or listed, and property profiles can be accessed from either maps or lists. There are many properties that meet the definition of a brownfield but are not funded by our program. They may be funded by states, localities, private or non-profit entities. The Brownfields data are reported by grant recipients via the ACRES database and updated and stored in Envirofacts monthly. For more information on the data updates to Envirofacts, please visit the Envirofacts Data Update page. For more information on the data provided through this webservice, please see the processing steps below, and see more information here: https://www.epa.gov/cleanups/cimc-about-data#brownfieldsp. The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Superfund National Priority List Sites as part of the CIMC web service. Superfund is a program administered by the EPA to locate, investigate, and clean up worst hazardous waste sites throughout the United States. EPA administers the Superfund program in cooperation with individual states and tribal governments. These sites include abandoned warehouses, manufacturing facilities, processing plants, and landfills - the key word here being abandoned. Only NPL sites have been included in Cleanups in My Community thus far. EPA maintains the NPL, which identifies for the States and the public those sites or other releases that appear to warrant remedial (long term) actions. These NPL sites fall into the following categories: Proposed: Sites may be proposed for the NPL and then may be placed on the NPL as final or be removed from the Proposed NPL. Final: Those sites placed on the NPL are called "final," and for these sites, a cleanup remedy is selected and implemented. However, it may be several years after construction of the remedy is completed before the hazardous substances are completely cleaned up or controlled in place. Deleted: After the clean up process is complete, and appropriate reviews confirm the area is cleaned up or the hazards are controlled, sites can be deleted from the NPL. For more information on the data provided through this web service, please see the processing steps below, and see more information here: https://www.epa.gov/cleanups/cimc-about-data#superfund. The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • Federal facilities are properties owned by the federal government. This data layer provides access to Federal facilities that are Superfund sites as part of the CIMC web service. Data are collected using the Superfund Enterprise Management System (SEMS) and transferred to the Facility Registry Service (FRS) for access by the public. Data about Federal facility Superfund sites are located on their own EPA web pages, and CIMC links to those pages. Links to the relevant web pages for each site are provided within the attribute table. Federal facility sites can be either Superfund sites or RCRA Corrective Action sites, or they may have moved from one program to the other and back. In Cleanups in My Community, you can map or list any of these Federal Facility sites. This data layer shows only those facilities that are Superfund Sites. RCRA federal facility sites and other Superfund NPL sites are included in other data layers as part of this web service. Superfund is a program administered by the EPA to locate, investigate, and clean up worst hazardous waste sites throughout the United States. EPA administers the Superfund program in cooperation with individual states and tribal governments. These sites include abandoned warehouses, manufacturing facilities, processing plants, and landfills - the key word here being abandoned. The CIMC web service was initially published in 2013, but the data are updated twice each month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Base Realignment and Closure (BRAC) Superfund Sites as part of the CIMC web service. EPA works with DoD to facilitate the reuse and redevelopment of BRAC federal properties. When the BRAC program began in the early 1990s, EPA worked with DoD and the states to identify uncontaminated areas and these parcels were immediately made available for reuse. Since then EPA has worked with DoD to clean up the contaminated portions of bases. These are usually parcels that were training ranges, landfills, maintenance facilities and other past waste-disposal areas. Superfund is a program administered by the EPA to locate, investigate, and clean up the worst hazardous waste sites throughout the United States. EPA administers the Superfund program in cooperation with individual states and tribal governments. These sites include abandoned warehouses, manufacturing facilities, processing plants, and landfills - the key word here being abandoned. This data layer shows Superfund Sites that are located at BRAC Federal Facilities. Additional Superfund sites and other BRAC sites (those that are not Superfund sites) are included in other data layers as part of this web service. BRAC Superfund Sites shown in this web service are derived from the epa.gov website and include links to the relevant web pages within the attribute table. Data about BRAC Superfund Sites are located on their own EPA web pages, and CIMC links to those pages. The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • This data layer provides access to Incidents of National Significance as part of the CIMC web service. Incidents of National Significance include all Presidentially-declared emergencies, major disasters, and catastrophes. Multiple federal departments and agencies, including EPA, coordinate actions to help prevent, prepare for, respond to, and recover from Incidents of National Significance. The Incidents of National Significance shown in this web service are derived from the epa.gov website and include links to the relevant web pages within the attribute table. Data about Incidents of National Significance are located on their own EPA web pages, and CIMC links to those pages. The CIMC web service was initially published in 2013, but the data are updated twice a month. The full schedule for data updates in CIMC is located here: https://ofmpub.epa.gov/frs_public2/frs_html_public_pages.frs_refresh_stats.
    1
    4 days ago
  • Cleanups in My Community (CIMC) is a public web application that enables integrated access through maps, lists and search filtering to site-specific information EPA has across all cleanup programs. CIMC taps into data publicly available from EPA's Facility Registry Service (FRS) - RCRA Corrective Action facilities, Brownfields properties and grant areas, Superfund NPL sites, other facility data) and web services (water monitoring stations, impaired waters, emergency responses, tribal boundaries, congressional districts, etc.) - and connects to other applications (e.g., Superfund's Public User Database, ACRES, RCRAInfo, etc.) to provide easy seamless access to site-specific cleanup information with explanatory text and within the context of related data. Data can be filtered by cleanup program, geography, environmental indicators, controls, and cleanup stage. CIMC also provides some web services that integrate these data for others to use in their applications.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. In response to the BP Spill in 2010, equipment in the TAGA buses monitored for air toxics known as volatile organic compounds (VOCs). The specific VOCs being monitored were benzene, toluene, and xylene. These substances are also associated with facilities such as gas stations, oil refineries, paper mills, and autobody shops. The TAGA monitoring found that these substances are not present or are being detected at low levels in the areas monitored along the Gulf Coast and in New Orleans, LA. The levels found were well below levels that would cause temporary discomfort, irritation, or other minor effects.
    1
    4 days ago
  • The Office of Emergency Management maintains information relevant to preventing emergencies before they occur, and/or mitigating the effects of emergency when they do occur. A principal element of this data asset is the information managed by the System for Risk Management Plans (SRMP), which compiles risk management plans submitted by facilities in accordance with the Clean Air Act, Section 112(r). Affected facilities are to develop risk management programs which will prevent and minimize consequences of accidental releases of certain hazardous chemicals that could harm public health and the environment. Another component of this data asset are the results generated by the Priority Assessment Model (PAM), which analyzes information concerning low-level chronic emissions from facilities and sets priorities (low, medium, high) for proactive controls on releases that do not necessarily pose imminent threats, but which may under adverse circumstances create unacceptable health or ecological risks. Also included are inspection records compiled by the Oil Inspection Program. Under the Clean Water Act Section 311, EPA regulates oil storage that meets a specific regulatory threshold. Facilities that store oil and meet the regulatory threshold need to prepare and implement a Spill Prevention, Control, and Countermeasures (SPCC) Plan which needs to be reviewed and approved by a professional engineer. Additionally, facilities with larger oil storage capacity may have to prepare and implement a Facility Response Plan. EPA is the lead federal response agency for oil spills occurring in inland waters. All other information that contributes to EPA's programs, policies and guidance concerning the prevention and mitigation of emergencies is included in this data asset.
    0
    4 days ago
  • The Office of Emergency Management compiles a wide variety of information in support of Emergency Preparedness, including certain elements of the System for Risk Management Plans (SRMP), a wide variety of training and guidance materials, inventories and readiness/O&M status of equipment and response personnel. Some of the data available to EPA for this emergency preparedness includes industry trade secret information. A major component of this data asset is information compiled in the Compendium of Environmental Testing Laboratories. This information allows OEM to direct samples recovered from emergency incidents to the appropriate laboratory certified to analyze the substances in question. Also included here are all types of field readiness information, training logs, and personnel contact information.
    0
    4 days ago
  • Hurricane Katrina made landfall in August 2005, causing widespread devastation along the Gulf Coast of the United States. EPA emergency response personnel worked with FEMA and state and local agencies to respond to the emergencies throughout the Gulf.
    1
    4 days ago
  • The LEPC data set contains over 3000 listings, as of 2008, for name and location data identifying Local Emergency Planning Committees (LEPCs). LEPCs are people responsible to develop an emergency response plan, review it at least annually, and provide information about chemicals in the community to citizens. Plans are developed by LEPCs with stakeholder participation. There is one LEPC for each of the more than 3,000 designated local emergency planning districts. The LEPC membership must include (at a minimum): Elected state and local officials; Police, fire, civil defense, and public health professionals; Environment, transportation, and hospital officials; Facility representatives; Representatives from community groups and the media.
    0
    4 days ago
  • The Katrina Air Quality System (AQS) contains records specific to the Katrina/Rita Emergency Response and provides this data to the Environmapper application.
    0
    4 days ago
  • Hurricane Katrina made landfall in August 2005, causing widespread devastation along the Gulf Coast of the United States. EPA emergency response personnel worked with FEMA and state and local agencies to respond to the emergencies throughout the Gulf.
    1
    4 days ago
  • Hurricane Katrina made landfall in August 2005, causing widespread devastation along the Gulf Coast of the United States. EPA emergency response personnel worked with FEMA and state and local agencies to respond to the emergencies throughout the Gulf.
    1
    4 days ago
  • Hurricane Katrina made landfall in August 2005, causing widespread devastation along the Gulf Coast of the United States. EPA emergency response personnel worked with FEMA and state and local agencies to respond to the emergencies throughout the Gulf.
    1
    4 days ago
  • Hurricane Katrina made landfall in August 2005, causing widespread devastation along the Gulf Coast of the United States. EPA emergency response personnel worked with FEMA and state and local agencies to respond to the emergencies throughout the Gulf.
    1
    4 days ago
  • The Office of Emergency Management retains records of all incident responses in which it participates. This data asset includes three major sources of information: (1) records maintained by the Regional Office On-Scene Coordinators, principally at the EPAOSC.org web site, (2) all records of incidents managed at the EPA National Response Center (NRC) at EPA Headquarters in Washington, DC and (3) records of responses to oil spills under the Clean Water Act, for which EPA is the oil spill response lead for inland waters. Regional response information is available through EPAOSC.org, but may also be stored elsewhere if the incident is of national significance. EPAOSC.org is a resource for On-Scene Coordinators to access, track and share information with OSCs throughout the country, but it also contains information open to the public. Incident-related environmental sampling data is maintained by the regional offices in the SCRIBE system. NRC records have been maintained in the Emergency Response Notification System (ERNS). This information is available to the public through the Right to Know Network (RTKnet.ombwatch.org). Incidents reported to NRC range from minor to serious, from an oil-sheen on water to a release of thousands of gallons. NRC reports are extensive, but also known to be incomplete, as many incidents are never reported, and those that are reported generally are not subject to verification.
    0
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. In response to the BP Spill in 2010, equipment in the TAGA buses monitored for air toxics known as volatile organic compounds (VOCs). The specific VOCs being monitored were benzene, toluene, and xylene. These substances are also associated with facilities such as gas stations, oil refineries, paper mills, and autobody shops. The TAGA monitoring found that these substances are not present or are being detected at low levels in the areas monitored along the Gulf Coast and in New Orleans, LA. The levels found were well below levels that would cause temporary discomfort, irritation, or other minor effects.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. In response to the BP Spill in 2010, equipment in the TAGA buses monitored for air toxics known as volatile organic compounds (VOCs). The specific VOCs being monitored were benzene, toluene, and xylene. These substances are also associated with facilities such as gas stations, oil refineries, paper mills, and autobody shops. The TAGA monitoring found that these substances are not present or are being detected at low levels in the areas monitored along the Gulf Coast and in New Orleans, LA. The levels found were well below levels that would cause temporary discomfort, irritation, or other minor effects.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. In response to the BP Spill in 2010, equipment in the TAGA buses monitored for air toxics known as volatile organic compounds (VOCs). The specific VOCs being monitored were benzene, toluene, and xylene. These substances are also associated with facilities such as gas stations, oil refineries, paper mills, and autobody shops. The TAGA monitoring found that these substances are not present or are being detected at low levels in the areas monitored along the Gulf Coast and in New Orleans, LA. The levels found were well below levels that would cause temporary discomfort, irritation, or other minor effects.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. In response to the BP Spill in 2010, equipment in the TAGA buses monitored for air toxics known as volatile organic compounds (VOCs). The specific VOCs being monitored were benzene, toluene, and xylene. These substances are also associated with facilities such as gas stations, oil refineries, paper mills, and autobody shops. The TAGA monitoring found that these substances are not present or are being detected at low levels in the areas monitored along the Gulf Coast and in New Orleans, LA. The levels found were well below levels that would cause temporary discomfort, irritation, or other minor effects.
    1
    4 days ago
  • The Trace Atmospheric Gas Analyzer (TAGA) buses are self-contained mobile laboratories that conduct instant-result monitoring of air quality at particular locations. From May 18-June 6, 2010, EPA’s TAGA buses monitored for the two chemicals found in the COREXIT dispersants that have the highest potential to get into the air in any significant amounts: EGBE (2-butoxyethanol) and dipropylene glycol monobutyl ether. In addition to being found in the COREXIT dispersants, these compounds are found in cleaning products and coatings. As a result, we have not beeen able to identify the source of the measured compounds. The TAGA buses detected very low levels of these chemicals in the air, at a limited number of the locations sampled along the Gulf Coast. The levels found were well below those that are likely to cause health effects, and suggest that the use of dispersants on the oil spill would not have a significant impact on air quality on land.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following the explosion and sinking of the Deepwater Horizon oil rig, a sea-floor oil gusher flowed for 87 days, until it was capped on 15 July 2010. In response to the BP oil spill, EPA sampled air, water, sediment, and waste generated by the cleanup operations.
    1
    4 days ago
  • This dataset provides all of the sampling data from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response. The data were collected between April 28, 2010 and September 29, 2010.
    0
    4 days ago
  • This dataset analyzes waste from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response, providing opportunity to query data sets by metadata criteria and find resulting raw datasets in CSV format.The data query tool allows users to download air, water and sediment sampling and monitoring data that has been collected in response to the BP oil spill. All sampling and monitoring data that has been collected to date is available for download as raw structured data.The query tools enables CSV file creation to be refined based on the following search criteria: date range (between April 28, 2010 and 9/29/2010); location by zip, city, or county; media (solid waste, weathered oil, air, surface water, liquid waste, tar, sediment, water); substance categories (based on media selection) and substances (based on substance category selection).
    0
    4 days ago
  • This dataset analyzes waste from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response, providing opportunity to query data sets by metadata criteria and find resulting raw datasets in CSV format.The data query tool allows users to download EPA's air, water and sediment sampling and monitoring data that has been collected in response to the BP oil spill. All sampling and monitoring data that has been collected to date is available for download as raw structured data.The query tools enables CSV file creation to be refined based on the following search criteria: date range (between April 28, 2010 and 9/29/2010); location by zip, city, or county; media (solid waste, weathered oil, air, surface water, liquid waste, tar, sediment, water); substance categories (based on media selection) and substances (based on substance category selection).
    0
    4 days ago
  • This dataset provides all of the monitoring data from the the British Petroleum Deepwater Horizon Rig Explosion Emergency Response. The data were collected between April 28, 2010 and September 29, 2010.
    0
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This data set is available as a national-scale file (>80MB) and as individual regional subsets. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. The URLs for each are as follows: Entire Country: https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip, Regional subsets: https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquadr[enter region number].zip (e.g., R6 subset URL https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquadr6.zip)
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/data/OSWER/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • Reference quads for emergency response reconnaissance developed for use by the US Environmental Protection Agency. Grid cells are based on densification of the USGS Quarterquad (1:12,000 scale or 12K) grids for the continental United States, Alaska, Hawaii and Puerto Rico and are roughly equivalent to 1:6000 scale (6K) quadrangles approximately 2 miles long on each side. Note: This file is a regional subset that has been extracted from a national file 6K quad file. Each regional extract includes a 20 mile buffer of tiles around each EPA Region. To access the national layer (size is greater than 80MB), go to https://edg.epa.gov/data/Public/OLEM/OLEM-OEM/6kquads_epa.zip.
    1
    4 days ago
  • This asset contains all Brownfield facility data. It includes all information necessary to track Brownfields grant recipients' environmental progress at Brownfield properties such as property location, acreage, identification and characterization, past uses, environmental assessment information and analyses, contaminants found, media affected, information on property cleanup, and information on site reuse and land revitalization. Regulatory authority for the collection and use of this information is found in the Small Business Liability Relief and Brownfields Revitalization Act of 2002 ("the Brownfields Law"), which amended the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980.
    1
    4 days ago
  • This asset includes all types of information regarding Brownfields grant programs that subsidize/support Brownfield cleanup. This includes EPA's Brownfields Program grant funding for brownfields assessment, cleanup, revolving loans, and environmental job training. Assessment grants provide funding for a grant recipient to inventory, characterize, assess, and conduct planning and community involvement related to brownfield sites. Revolving Loan Fund Grants enable States, political subdivisions, and Indian tribes to make low interest loans to carryout cleanup activities at brownfields properties. Cleanup grants provide funding for a grant recipient to carry out cleanup activities at brownfield sites. Environmental Workforce Development and Job Training Grants are designed to provide funding to eligible entities, including nonprofit organizations, to recruit, train, and place predominantly low-income and minority, unemployed and under-employed residents of solid and hazardous waste-impacted communities with the skills needed to secure full-time, sustainable employment in the environmental field and in the assessment and cleanup work taking place in their communities. Training, Research, and Technical Assistance Grants provide funding to eligible organizations to provide training, research, and technical assistance to facilitate brownfields cleanup. Regulatory authority for the collection and use of this information is found in the Small Business Liability Relief and Brownfields Revitalization Act of 2002 ("the Brownfields Law"), which amended the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980.
    0
    4 days ago
  • This asset contains resources provided by EPA's Brownfields and Land Revitalization program that can be used for the assessment, cleanup, and redevelopment of brownfields sites and land revitalization activities. To help implement the program, EPA provides information on the Brownfields law, success stories from Brownfields grantees, technical information and resources to aid in the assessment and cleanup of brownfields properties, partnerships to promote the cleanup and reuse of Brownfields, and initiatives that explore sector-based solutions, enhance environmental quality, spur economic development, and revitalize communities. This asset includes fact sheets, success stories, training, policy, and guidance documents. Regulatory authority for the collection and use of this information is found in the Small Business Liability Relief and Brownfields Revitalization Act of 2002 ("the Brownfields Law"), which amended the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980.
    0
    4 days ago
  • The Assessment, Cleanup and Redevelopment Exchange System (ACRES) is an online database for Brownfields Grantees to electronically submit data directly to EPA.
    0
    4 days ago
  • This asset includes the EPA Federal Agency Hazardous Waste Compliance Docket (Docket), which is required by Section 120(c) of the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA). The Docket contains information reported to EPA by federal facilities that manage hazardous waste or from which hazardous substances, pollutants or contaminants have been or may be released. The Docket serves three major purposes: 1. To identify all federal facilities that must be evaluated through the site assessment process to determine whether they pose a risk to human health and the environment sufficient to warrant inclusion on the National Priorities List (NPL); 2. To compile and maintain the information submitted to EPA on such facilities under the provisions listed in section 120(c) of CERCLA; and 3. To provide a mechanism to make the information available to the public. The docket includes facilities which have provided information to EPA through documents such as reports under a Federal agency environmental restoration program, regardless of the absence of section 103 reporting. E-Docket is an internal business management tool that will improve the tracking and record keeping of information about facilities that have been identified as potential Docket sites. The functionality of the system is basic record tracking, and it will contain a list of draft proposed facilities which can be sorted based on Agency ownership, region, or status (Draft Proposed, Proposed, Added, or Not Added). The information compiled in the tool is publicly available. The data asset also includes the FFRRO Regional Work Planning Application, which is a tool for the Superfund Federal Facilities Response Program. It collects regional site-specific planning targets for program measures. This data is entered by the regions and used by HQ to estimate and target program accomplishments.
    1
    4 days ago
  • This asset includes information related to Cleanups at Federal Facilities. Information is provided about contaminated federal facility sites in specific communities, with access to technical fact sheets and tools and resources to help government agencies and their contractors fulfill cleanup obligations. EPA's federal facility information is easily accessible to ensure effective stakeholder involvement and accountability at federal facilities. Multiple federal statutes establish requirements for EPA and other federal agencies to protect health and the human environment through cleanups at Federal Facilities, including the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980, which was amended by the Superfund Amendments and Reauthorization Act (SARA) in 1986; the Defense Authorization Amendments and Base Realignment and Closure Acts (BRAC) of 1998 and the Defense Base Closure and Realignment Act of 1990; and the Resource Conservation and Recovery Act (RCRA), as amended by the Hazardous and Solid Waste Amendments of 1984 (HS WA) including Subtitle C (hazardous waste), Subtitle D (solid waste), Subtitle I (underground storage tanks), and Subtitle J (Medical Waste Tracking Act of 1988).
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Center for Program Analysis (CPA) initiated the RE-Powering America’s Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. As part of the RE-Powering America's Land Initiative, the EPA and the U.S. Department of Energy's National Renewable Energy Laboratory (NREL) evaluated the feasibility of developing renewable energy production on Superfund, brownfields, and former landfill or mining sites. These reports pair EPA's expertise on contaminated sites with the renewable energy expertise of NREL.
    1
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. Using publically available information, RE-Powering maintains a list of completed renewable energy installations on contaminated sites and landfills. To date, the RE-Powering Initiative has identified 179 renewable energy installations on 171 contaminated lands, landfills, and mine sites, with a cumulative installed capacity of just over 1,124 megawatts (MW) and consistent growth in total installations since the inception of the RE-Powering Initiative. This dataset is current as of April 2016.
    2
    4 days ago
  • The U.S. Environmental Protection Agency (EPA) Office of Land and Emergency Management’s (OLEM) Office of Communications, Partnerships and Analysis (OCPA) initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated lands, landfills, and mine sites provide for developing renewable energy in the United States. EPA developed national level site screening criteria in partnership with the U.S. Department of Energy (DOE) National Renewable Energy Laboratory (NREL) for wind, solar, biomass, and geothermal facilities. While the screening criteria demonstrate the potential to reuse contaminated land for renewable energy facilities, the criteria and data are neither designed to identify the best sites for developing renewable energy nor all-inclusive. Therefore, more detailed, site-specific analysis is necessary to identify or prioritize the best sites for developing renewable energy facilities based on the technical and economic potential. Please note that these sites were only pre-screened for renewable energy potential. The sites were not evaluated for land use constraints or current on the ground conditions. Additional research and site-specific analysis are needed to verify viability for renewable energy potential at a given site.
    1
    4 days ago
  • This is a provisional dataset that contains point locations for the subset of Community Action for a Renewed Environment (CARE) grants given out by the US EPA. CARE is a competitive grant program that offers an innovative way for a community to organize and take action to reduce toxic pollution in its local environment. There are many limitations to the data so it is advised that these metadata be read carefully before use. Although the records for these grant locations are drawn directly from the official EPA grants repository (IGMS Integrated Grants Management System), it is important to know that the IGMS was designed for purposes that did not include accurately portraying the grants place of performance on a map. Instead, the IGMS grant recipients mailing address is the primary source for grant locations. Particularly for statewide grants that are administered via State and Regional headquarters, the grant location data should not be interpreted as the grants place of performance. In 2012, a policy was established to start to collect the place of performance as a pilot for newly awarded grants that were deemed community-based in nature and for these the grant location depicted in this database will be a more reliable indicator of the actual place of performance. As for the locational accuracy of these points, there is no programmatic certification process, however, they are being entered by the Grant Project Officers who are most familiar with the details of the grants, apart from the grantees themselves. Limitations notwithstanding, this is a first-of-breed attempt to map all of the Agencys grants, using the best internal geocoding algorithms available, and is a useful tool for getting to an understanding of the distribution of USEPA grant-giving. The CARE Grants layer contains Places of Performance for single locations or areas where CARE grants are applied.
    0
    4 days ago
  • This layer provides point locations for Brownfields Grants as derived from the Cleanups in My Community (CIMC) database. Locations were derived from Cleanups in My Community areas and points.  For areas, a centroid was created for each area or place of performance. For grants where there were multiple areas, a centroid was created for each of those areas and then inserted into the layer as separate records, with each record representing a centroid.
    0
    4 days ago
  • EPA's management information system for grants programs is the Integrated Grants Management System (IGMS), which awards, administers, and monitors grants. Grants are regularly awarded to Federal, State, or local government agencies, universities, and other institutions that support EPA's environmental programs. Specific types of agreements include assistance agreements, grants, cooperative agreements, interagency agreements, and other types of program support agreements administered by Headquarters or EPA regions. This dataset contains point locations for all grants given out by the USEPA going back to the 1960s till the end of 2012.
    0
    4 days ago
  • EPA's management information system for grants programs is the Integrated Grants Management System (IGMS), which awards, administers, and monitors grants. Grants are regularly awarded to Federal, State, or local government agencies, universities, and other institutions that support EPA's environmental programs. Specific types of agreements include assistance agreements, grants, cooperative agreements, interagency agreements, and other types of program support agreements administered by Headquarters or EPA regions. This dataset contains point locations for grants given out by the USEPA.
    0
    4 days ago
  • EF_TRI is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only points from the TRIS (Toxics Release Inventory System) program.
    1
    4 days ago
  • EF_RCRA is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only points from the RCRAInfo (Resource Conservation and Recovery Act Information) program.
    1
    4 days ago
  • EF_NPL is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only NPL (National Priority List) points from the SEMS (Superfund Enterprise Management System) database.
    1
    4 days ago
  • EF_NPDES is a subset of facilities from FRS_PROGRAM_FACILITY and associataed best-available geospatial coordinates which are refreshed daily. The layer shows only points from the NPDES (National Pollutant Discharge Elimination System) and PCS (Permit Compliance System) programs as reported in ICIS (Integrated Compliance Information System).
    2
    4 days ago
  • EF_ICIS_AIR is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only points from the 'ICIS-AIR' (Integrated Compliance Information System for Air) program. The program query is 'AIR'. The ICIS-AIR subset is updated weekly.
    2
    4 days ago
  • EF_BR is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only points from the 'BR' (Biennial Report) program. The program query is 'BR'. The BR subset is updated weekly.
    1
    4 days ago
  • EF_ACRES is a subset of facilities from FRS_PROGRAM_FACILITY and associated best-available geospatial coordinates. Facility Registry Service (FRS) data are refrehsed daily. The layer shows only points from the 'ACRES' (Assessment, Cleanup and Redevelopment Exchange System) program.
    1
    4 days ago
  • This data set depicts native allotment parcels. Data attributes are a snapshot of the BLM-AK Land Information System Database and are only accurate as that database.
    0
    4 days ago
  • These data provide mapping, display, and analysis capabilities for the TRI National Analysis data at the following geographic levels: state, county, large aquatic ecosystem, metro/micropolitan statistical area, and facility. See the links below for data from specific reporting years. The TRI National Analysis is EPA's annual interpretation and summary of the most recent TRI data. It highlights how toxic chemical wastes were managed, where toxic chemicals were released and in what quantities, and how the TRI data compare to data from previous years. This dataset reports US, state, county, large aquatic ecosystem, metro/micropolitan statistical area, and facility level statistics of TRI releases, including information on: number of TRI facilities in the geographic area and their releases (total releases, as well as releases to water, air, and land); population information, including populations living within 1 mile of TRI facilities (total population, percent minority, and in percent under the poverty line); and Risk Screening Environmental Indicators (RSEI) model related pounds, toxicity-weighted pounds, and RSEI score. The source of administrative boundary data is the 2013 cartographic boundary shapefiles. Location of facilities is provided by EPA's Facility Registry Service (FRS). Large Aquatic Ecosystems boundaries were derived from the hydrologic unit boundaries and codes for the United States, Puerto Rico, and the U.S. Virgin Islands. It was revised for inclusion in the National Atlas of the United States of America (November 2002), and updated to match the streams file created by the USGS National Mapping Division (NMD) for the National Atlas of the United States of America.
    0
    4 days ago
  • EPAs public geospatial metadata service provides external parties (Data.gov, GeoPlatform.gov, and the general public) with access to EPA's geospatial metadata records including records describing facility data, emergency response data, and other environmental data. Geospatial metadata records are harvested to this central location from EPA's distributed regional and program offices.
    0
    4 days ago
  • The EPA Recovery Mapper is an Internet interactive mapping application that allows users to discover information about every American Recovery and Reinvestment Act (ARRA) award that EPA has funded for six programs. By integrating data reported by the recipients of Recovery Act funding and data created by EPA, this application delivers a level of transparency and public accessibility to users interested in EPA's use of Recovery Act monies. The application is relatively easy to use and builds on the same mapping model as Google, Bing, MapQuest and other commonly used mapping interfaces. EPA Recovery Mapper tracks each award made by each program and gives basic Quick Facts information for each award including award name, location, award date, dollar amounts and more. Data Summaries for each EPA program or for each state are provided displaying dollars for Total Awarded, Total Received (Paid), and Total Jobs This Quarter by Recovery for the latest quarter of data released by Recovery.gov. The data are reported to the government and EPA four times a year by the award recipients. The latest quarterly report will always be displayed in the EPA Recovery Mapper. In addition, the application provides many details about each award. Users will learn more about how to access and interpret these data later in this document. Data shown in the EPA Recovery Mapper are derived from information reported back to FederalReporting.gov from the recipients of Recovery Act funding. EPA reviews the recipient reported data and works with the recipients to correct the data when errors are found. Please note that the dollar amounts displayed at Recovery.gov may differ somewhat from the amounts in this application because EPA Recovery Mapper includes awards that EPA has funded for Superfund sites cleanups that were awarded by the US Army Corps of Engineers. Also, EPA Recovery Mapper also does not display awards for management and oversight and awards made to EPA's Inspector General which account for less than 1.4% of the Recovery Act funding that EPA has received.
    1
    4 days ago
  • This web service depicts nearly 17,000 neighborhood boundaries in over 650 U.S. cities. Zillow created the neighborhood boundaries and is sharing them with the public under a Creative Commons license. Users of the data must credit Zillow as the data source. Additional information regarding this dataset can be found at https://www.zillow.com/howto/api/neighborhood-boundaries.htm. Note that neighborhood boundaries are not formal geographic boundaries for legal or jurisdictional purposes and should not be interpreted as such.
    1
    4 days ago
  • This map service displays Level III and Level IV Ecoregions of the United States and was created from ecoregion data obtained from the U.S. Environmental Protection Agency Office of Research and Development's Western Ecology Division. The original ecoregion data was projected from Albers to Web Mercator for this map service. To download shapefiles of ecoregion data (in Albers), please go to: https://dmap-prod-oms-edc.s3.us-east-1.amazonaws.com/index.html#ORD/Ecoregions/. IMPORTANT NOTE ABOUT LEVEL IV POLYGON LEGEND DISPLAY IN ARCMAP: Due to the limitations of Graphical Device Interface (GDI) resources per application on Windows, ArcMap does not display the legend in the Table of Contents for the ArcGIS Server service layer if the legend has more than 100 items. As of December 2011, there are 968 unique legend items in the Level IV Ecoregion Polygon legend. Follow this link (http://support.esri.com/en/knowledgebase/techarticles/detail/33741) for instructions about how to increase the maximum number of ArcGIS Server service layer legend items allowed for display in ArcMap. Note the instructions at this link provide a slightly incorrect path to "Maximum Legend Count". The correct path is HKEY_CURRENT_USER > Software > ESRI > ArcMap > Server > MapServerLayer > Maximum Legend Count. When editing the "Maximum Legend Count", update the field, "Value data" to 1000. To download a PDF version of the Level IV ecoregion map and legend, go to https://dmap-prod-oms-edc.s3.us-east-1.amazonaws.com/ORD/Ecoregions/us/Eco_Level_IV_US_pg.pdf. Ecoregions denote areas of general similarity in ecosystems and in the type, quality, and quantity of environmental resources. They are designed to serve as a spatial framework for the research, assessment, management, and monitoring of ecosystems and ecosystem components. These general purpose regions are critical for structuring and implementing ecosystem management strategies across federal agencies, state agencies, and nongovernment organizations that are responsible for different types of resources within the same geographical areas. The approach used to compile this map is based on the premise that ecological regions can be identified through the analysis of patterns of biotic and abiotic phenomena, including geology, physiography, vegetation, climate, soils, land use, wildlife, and hydrology. The relative importance of each characteristic varies from one ecological region to another. A Roman numeral hierarchical scheme has been adopted for different levels for ecological regions. Level I is the coarsest level, dividing North America into 15 ecological regions. Level II divides the continent into 52 regions (Commission for Environmental Cooperation Working Group, 1997). At Level III, the continental United States contains 104 regions whereas the conterminous United States has 85 (U.S. Environmental Protection Agency, 2005). Level IV ecoregions (n = 968) are further subdivisions of Level III ecoregions. Methods used to define the ecoregions are explained in Omernik (1995, 2004), Omernik and others (2000), and Gallant and others (1989). Literature cited: Commission for Environmental Cooperation Working Group, 1997, Ecological regions of North America- toward a common perspective: Montreal, Commission for Environmental Cooperation, 71 p. Gallant, A.L., Whittier, T.R., Larsen, D.P., Omernik, J.M., and Hughes, R.M., 1989, Regionalization as a tool for managing environmental resources: Corvallis, Oregon, U.S. Environmental Protection Agency, EPA/600/3-89/060, 152p. Omernik, J.M., 1995, Ecoregions - a framework for environmental management, in Davis, W.S. and Simon, T.P., eds., Biological assessment and criteria-tools for water resource planning and decision making: Boca Raton, Florida, Lewis Publishers, p.49-62. Omernik, J.M., Chapman, S.S., Lillie, R.A., and Dumke, R.T., 2000, Ecoregions of Wisconsin: Transactions of the Wisconsin Academy of Science, Arts, and Letters, v. 88, p. 77-103. Omernik, J.M., 2004, Perspectives on the nature and definitions of ecological regions: Environmental Management, v. 34, Supplement 1, p. s27-s38. Comments and questions regarding ecoregion development should be addressed to Glenn Griffith, Dynamac Corporation, c/o US EPA., 200 SW 35th Street, Corvallis, OR 97333, 541-754-4465, email:griffith.glenn@epa.gov Alternate: James Omernik, USGS, c/o US EPA, 200 SW 35th Street, Corvallis, OR 97333, 541-754-4458, email:omernik.james@epa.gov
    1
    4 days ago
  • This SEGS web service contains EPA facilities, EPA facilities labels, small- and large-scale versions of EPA region boundaries, and EPA region boundaries extended to the 200nm Exclusive Economic Zone (EEZ). Small scale EPA boundaries and boundaries extended to the EEZ render at scales of less than 5 million, large scale EPA boundaries draw at scales greater than or equal to 5 million. EPA facilities labels draw at scales greater than 2 million. Data used to create this web service are available as a separate download at the Secondary Linkage listed above. Full FGDC metadata records for each layer may be found by clicking the layer name in the web service table of contents (available through the online link provided above) and viewing the layer description. This SEGS dataset was produced by EPA through the Office of Environmental Information.
    1
    4 days ago
  • This downloadable package contains the following layers: EPA facility points, EPA region boundary polygons and EPA region boundary polygons extended to the 200nm Exclusive Economic Zone (EEZ). Included in this package are a file geodatabase (v. 10.0), Esri ArcMap map document (v. 10.0) and XML files for this record and the layer level metadata. This SEGS dataset was produced by EPA Office of Environmental Information (OEI).
    1
    4 days ago
  • This interactive map shows information on concluded enforcement actions and cases from federal fiscal year (FY) 2018. They include: civil enforcement actions taken by EPA at facilities, criminal cases prosecuted by EPA under federal statutes and the U.S. Criminal Code, and cases in which EPA provided significant support to cases prosecuted under state criminal laws. They do not include: state civil cases or civil cases where EPA provide significant support to a state. The indicators on the map generally mark the location of the site or facility where the violations occurred or were discovered. Data are updated from the EPA program system on a weekly basis.
    0
    4 days ago
  • This downloadable data package contains the following map layer: An ESRI polygon layer which depicts the boundaries of each US county. It has been joined with a US EPA value-added dataset derived from the 2007 USDA Census of Agriculture. This USDA dataset was procured for EPA through the Office of Water (OW). Included in this package are a shapefile (v. 10.0), Esri ArcMap map document (v. 10.0) and XML files for this record and the layer level metadata.
    1
    4 days ago
  • This downloadable data package contains the following map layer: An ESRI polygon layer which depicts the boundaries of each US county. It has been joined with a US EPA value-added dataset derived from the 2007 USDA Census of Agriculture. This USDA dataset was procured for EPA through the Office of Water (OW). Included in this package are a shapefile (v. 10.0), Esri ArcMap map document (v. 10.0) and XML files for this record and the layer level metadata.
    1
    4 days ago
  • This interactive map shows information on enforcement actions and cases from 2015. They include civil enforcement actions taken by EPA at facilities, criminal cases prosecuted by EPA under federal statutes and the U.S. Criminal Code, and cases in which EPA provided significant support to cases prosecuted under state criminal laws.
    1
    4 days ago
  • This downloadable data package shows information on enforcement actions and cases from 2015. They include civil enforcement actions taken by EPA at facilities, criminal cases prosecuted by EPA under federal statutes and the U.S. Criminal Code, and cases in which EPA provided significant support to cases prosecuted under state criminal laws.
    1
    4 days ago
  • This layer displays points of industrial uses extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of consumer uses extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of consumer and commercial uses extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of commercial uses extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of children's products uses extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of submission sites extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This data download package contains the following map layers: CDR sites, CDR chemicals, and CDR commercial and industrial submissions. Layers are drawn at all scales. Included in this package are a file geodatabase, Esri ArcMap map document and XML files of this and layer-level metadata records. Full FGDC metadata records for each layer are also contained in the database. This dataset was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • This layer displays points of per site chemical use extracted from the 2012 Chemical Data Reporting (CDR) database. The CDR database contains comprehensive use and exposure information on the most widely used chemicals in the United States. This layer is drawn at all scales and was procured for EPA through the Office of Pollution Prevention and Toxics (OPPT).
    1
    4 days ago
  • The Acute Exposure Guideline Levels Chemical Listing provides a complete listing of risk exposure guidelines from rare exposure to certain chemicals.
    0
    4 days ago
  • This web service contains the following layer: PM25Review35Cities_with2000to2014data. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (available through the online link provided above) and viewing the layer description.
    0
    4 days ago
  • This web service contains the following layer: PM25_2014_SesonReview_35CBSA. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (available through the online link provided above) and viewing the layer description.
    0
    4 days ago
  • This web service contains the following layer: OzoneReview35Cities_with2000to2014data. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (available through the online link provided above) and viewing the layer description.
    0
    4 days ago
  • This web service contains the following layer: CBSA35_2014OzoneAQI_data. Full FGDC metadata record for this layer may be found by clicking the layer name at the web service endpoint (available through the online link provided above) and viewing the layer description.
    0
    4 days ago
  • This downloadable data package contains the following state level layers: Ozone 8-hr (1997 standard), Ozone 8-hr (2008 standard), Lead (2008 standard), SO2 1-hr (2010 standard), PM2.5 24hr (2006 standard), PM2.5 Annual (1997 standard), PM2.5 Annual (2012 standard), and PM10 (1987 standard). Included in this package are a file geodatabase and full FGDC metadata records for each layer. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following state level layers:Ozone 8-hr (1997 standard), Ozone 8-hr (2008 standard), Lead (2008 standard), SO2 1-hr (2010 standard), PM2.5 24hr (2006 standard), PM2.5 Annual (1997 standard), PM2.5 Annual (2012 standard), PM10 (1987 standard), and CO (1990 standard). Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NonattainmentAreas/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This US EPA Office of Air and Radiation, Office of Air Quality Planning and Standards, Air Quality Assessment Division, Air Quality Analysis Group (OAR, OAQPS, AQAD, AQAG) web service contains the following layers created from the 2008, 2011 and 2014 National Emissions Inventory (NEI): Carbon Monoxide (CO), Lead, Ammonia (NH3), Nitrogen Oxides (NOx), Particulate Matter 10 (PM10), Particulate Matter 2.5 (PM2.5), Sulfur Dioxide (SO2), Volatile Organic Compounds (VOC). Each of these layers conatin county level emissions for 2008, 2011, and 2014. Layers are drawn at all scales. The National Emission Inventory (NEI) is a comprehensive and detailed estimate of air emissions of criteria pollutants, criteria precursors, and hazardous air pollutants from air emissions sources. The NEI is released every three years based primarily upon data provided by State, Local, and Tribal air agencies for sources in their jurisdictions and supplemented by data developed by the US EPA. The NEI is built using the Emissions Inventory System (EIS) first to collect the data from State, Local, and Tribal air agencies and then to blend that data with other data sources. NEI point sources include emissions estimates for larger sources that are located at a fixed, stationary location. Point sources in the NEI include large industrial facilities and electric power plants, airports, and smaller industrial, non-industrial and commercial facilities. A small number of portable sources such as some asphalt or rock crushing operations are also included. Some states voluntarily also provide facilities such as dry cleaners, gas stations, and livestock facilities, which are otherwise included in the NEI as nonpoint sources. The emissions potential of each facility determines whether that facility should be reported as a point source, according to emissions thresholds set in the Air Emissions Reporting Rule (AERR). NEI Point Sources are all included in the EIS Point Data Category. NEI nonpoint sources include emissions estimates for sources which individually are too small in magnitude to report as point sources. These emissions sources are included in the NEI as a county total or tribal total (for participating tribes). Examples include residential heating, commercial combustion, asphalt paving, and commercial and consumer solvent use. NEI nonpoint sources are all included in the EIS Nonpoint Data Category.
    1
    4 days ago
  • This US EPA Office of Air and Radiation, Office of Air Quality Planning and Standards, Air Quality Assessment Division, Air Quality Analysis Group (OAR, OAQPS, AQAD, AQAG) web service contains the following layers created from the 2008, 2011 and 2014 National Emissions Inventory (NEI): All Pollutants, which include hazardous air pollutants (HAPs) and criteria air pollutants (CAPs) Criteria Majors, which include CAP point source emissions ≥ 100 tons per year (except Lead which is ≥ 0.5 tons per year) Criteria Minors, which include CAP point source emissions < 100 tons per year (except Lead which is < 0.5 tons per year). Layers are drawn at all scales. The National Emission Inventory (NEI) is a comprehensive and detailed estimate of air emissions of criteria pollutants, criteria precursors, and hazardous air pollutants from air emissions sources. The NEI is released every three years based primarily upon data provided by State, Local, and Tribal air agencies for sources in their jurisdictions and supplemented by data developed by the US EPA. The NEI is built using the Emissions Inventory System (EIS) first to collect the data from State, Local, and Tribal air agencies and then to blend that data with other data sources. NEI point sources include emissions estimates for larger sources that are located at a fixed, stationary location. Point sources in the NEI include large industrial facilities and electric power plants, airports, and smaller industrial, non-industrial and commercial facilities. A small number of portable sources such as some asphalt or rock crushing operations are also included. Some states voluntarily also provide facilities such as dry cleaners, gas stations, and livestock facilities, which are otherwise included in the NEI as nonpoint sources. The emissions potential of each facility determines whether that facility should be reported as a point source, according to emissions thresholds set in the Air Emissions Reporting Rule (AERR). NEI Point Sources are all included in the EIS Point Data Category. NEI nonpoint sources include emissions estimates for sources which individually are too small in magnitude to report as point sources. These emissions sources are included in the NEI as a county total or tribal total (for participating tribes). Examples include residential heating, commercial combustion, asphalt paving, and commercial and consumer solvent use. NEI nonpoint sources are all included in the EIS Nonpoint Data Category.
    1
    4 days ago
  • This web service contains layers that depict annual emissions for 2014 at the facility and county level for the following criterial pollutants: CO, Lead, NH3, NOx, PM10, PM25, SO2, and VOC. The National Emissions Inventory (NEI) is a comprehensive and detailed estimate of air emissions of criteria pollutants, criteria precursors, and hazardous air pollutants from air emissions sources. The NEI is released every three years based primarily upon data provided by State, Local, and Tribal air agencies for sources in their jurisdictions and supplemented by data developed by the US EPA. The NEI is built using the Emissions Inventory System (EIS) first to collect the data from State, Local, and Tribal air agencies and then to blend that data with other data sources. NEI point sources include emissions estimates for larger sources that are located at a fixed, stationary location. Point sources in the NEI include large industrial facilities and electric power plants, airports, and smaller industrial, non-industrial and commercial facilities. A small number of portable sources such as some asphalt or rock crushing operations are also included. Some states voluntarily also provide facilities such as dry cleaners, gas stations, and livestock facilities, which are otherwise included in the NEI as nonpoint sources. The emissions potential of each facility determines whether that facility should be reported as a point source, according to emissions thresholds set in the Air Emissions Reporting Rule (AERR). NEI Point Sources are all included in the EIS Point Data Category. NEI nonpoint sources include emissions estimates for sources which individually are too small in magnitude to report as point sources. These emissions sources are included in the NEI as a county total or tribal total (for participating tribes). Examples include residential heating, commercial combustion, asphalt paving, and commercial and consumer solvent use. NEI nonpoint sources are all included in the EIS Nonpoint Data Category.
    0
    4 days ago
  • This web service layer, Ozone 8-hr (2015 standard), displays identified state level areas where ground-level ozone have not met the National Ambient Air Quality Standards (NAAQS) established in 2015 for ground-level ozone and have been designated "nonattainment” areas (NAA)". Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NonattainmentAreas/MapServer) and viewing the layer description. The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www.epa.gov/oar/oaqps/greenbk/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/oar/oaqps/greenbk/regcntct.html). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layer: PM2.5 Annual 2012 NAAQS State Level. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA2012PM25Annual/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layer: SO2 2010 NAAQS State Level. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA2010SO21hour/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: Ozone 2008 NAAQS NAA State Level and Ozone 2008 NAAQS NAA National Level. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA2008Ozone8hour/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: Lead NAA 2008 NAAQS and Lead NAA Centroids 2008 NAAQS. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA2008Lead/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: PM2.5 24hr 2006 NAAQS State Level and PM2.5 24hr 2006 NAAQS National. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA2006PM2524hour/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: PM2.5 Annual 1997 NAAQS State Level and PM2.5 Annual 1997 NAAQS National . It also contains the following tables: maps99.FRED_MAP_VIEWER.%fred_area_map_data and maps99.FRED_MAP_VIEWER.%fred_area_map_view. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA1997PM25Annual/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as “attainment” (meeting), “nonattainment” (not meeting), or “unclassifiable” (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: Ozone 1997 NAAQS NAA State Level and Ozone 1997 NAAQS NAA National Level. Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA1997Ozone8hour/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www3.epa.gov/airquality/greenbook/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service layer, Carbon Monoxide (1990 NAAQS), displays identified state level areas where carbon monoxide pollution has not met the National Ambient Air Quality Standards (NAAQS) established in 1990 for and have been designated "nonattainment” areas (NAA)". Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NonattainmentAreas/MapServer) and viewing the layer description. The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www.epa.gov/oar/oaqps/greenbk/index.html. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/oar/oaqps/greenbk/regcntct.html). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layer: PM10 Nonattainment Areas (1987 NAAQS). Full FGDC metadata records for each layer may be found by clicking the layer name at the web service endpoint (https://gispub.epa.gov/arcgis/rest/services/OAR_OAQPS/NAA1987PM10/MapServer) and viewing the layer description. These layers identify areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for criteria air pollutants and have been designated "nonattainment” areas (NAA)". The data are updated weekly from an OAQPS internal database. However, that does not necessarily mean the data have changed. The EPA Office of Air Quality Planning and Standards (OAQPS) has set National Ambient Air Quality Standards for six principal pollutants, which are called "criteria" pollutants. Under provisions of the Clean Air Act, which is intended to improve the quality of the air we breathe, EPA is required to set National Ambient Air Quality Standards for six common air pollutants. These commonly found air pollutants (also known as "criteria pollutants") are found all over the United States. They are particle pollution (often referred to as particulate matter), ground-level ozone, carbon monoxide, sulfur oxides, nitrogen oxides, and lead. For each criteria pollutant, there are specific procedures used for measuring ambient concentrations and for calculating long-term (quarterly or annual) and/or short-term (24-hour) exposure levels. The methods and allowable concentrations vary from one pollutant to another, and within NAAQS revisions for each pollutant. These pollutants can harm your health and the environment, and cause property damage. Of the six pollutants, particle pollution and ground-level ozone are the most widespread health threats. EPA calls these pollutants "criteria" air pollutants because it regulates them by developing human health-based and/or environmentally-based criteria (science-based guidelines) for setting permissible levels. The set of limits based on human health is called primary standards. Another set of limits intended to prevent environmental and property damage is called secondary standards. A geographic area that meets or does better than the primary standard is called an attainment area; areas that don't meet the primary standard are called nonattainment areas. In some cases, a designated nonattainment area can include portions of 2, 3, or 4 states rather than falling entirely within a single state. Multi-state areas have had different state portions handled through up to 3 separate EPA regional offices. The actions of EPA and the state governments for separate portions of such areas are not always simultaneous. While some areas have had coordinated action from all related states on the same day, other areas (so-called "split areas") have had delays of several months, ranging up to more than 2 years, between different states. EPA must designate areas as meeting (attainment) or not meeting (nonattainment) the standard. A designation is the term EPA uses to describe the air quality in a given area for any of the six common air pollutants (criteria pollutants). After EPA establishes or revises a primary and/or secondary National Ambient Air Quality Standard (NAAQS), the Clean Air Act requires EPA to designate areas as "attainment" (meeting), "nonattainment" (not meeting), or "unclassifiable" (insufficient data) after monitoring data is collected by state, local and tribal governments. Once nonattainment designations take effect, the state and local governments have three years to develop implementation plans outlining how areas will attain and maintain the standards by reducing air pollutant emissions. For further information please refer to: https://www.epa.gov/approved-sips/regional-sip-coordinators. Questions concerning the status of nonattainment areas, their classification and EPA policy should be directed to the appropriate Regional Offices (https://www.epa.gov/approved-sips/regional-sip-coordinators). EPA Headquarters should be contacted only when the Regional Office is unable to answer a question.
    1
    4 days ago
  • This web service contains the following layers: Mandatory Class 1 Federal Area polygons and Mandatory Class 1 Federal Area labels in the United States. The polygon layer draws at all scales. The labels draw at scales greater than or equal to 1:3 million. Data used to create this web service are available as a separate download at the secondary linkage listed above. Full FGDC metadata are available by clicking the layer name in the web service table of contents and clicking the Full Metadata link in the layer description. This dataset was developed by EPA's Office of Air Quality Planning and Standards (OAQPS) based on features originating from several data sources, including USEPA, USFS, USFWS, NPS and BIA.
    1
    4 days ago
  • This downloadable package contains the following layers: Mandatory Class 1 Federal Area polygons in the United States. Included in this package are a file geodatabase, Esri ArcMap map document and an XML file of this metadata record. This dataset was developed by EPA's Office of Air Quality Planning and Standards (OAQPS) based on features originating from several data sources, including USEPA, USFS, USFWS, NPS and BIA.
    1
    4 days ago
  • This map shows the average number of days per year in which coastal waters rose above the local threshold for minor flooding at 33 sites along the U.S. coast. Each small bar graph compares the first decade of widespread measurements (the 1950s in orange) with the most recent decade (the 2010s in purple). For more information: www.epa.gov/climate-indicators
    0
    4 days ago
  • This GIS dataset contains points which depict air quality monitors within EPA's Air Quality System (AQS) monitoring network. This dataset is updated weekly to reflect the most recent changes in the monitoring network. The monitors are generally operated by State, local, and tribal air pollution control agencies using procedures specified by the U.S. EPA. These agencies collect the data, quality assure it, and then submit it to the EPA Air Quality System (AQS). The GIS dataset includes monitor information and links to download historic air quality data at each monitor.
    1
    4 days ago
  • This map service contains participants in EPA's Air Quality Flags Program. The map service also includes the current day's AQI forecast for each participant in the program. The Air Quality Flag Program alerts organizations to the local air quality forecast and helps them to take actions to protect people’s health, including those with asthma. Here's how it works: each day your organization raises a flag that corresponds to how clean or polluted the air is. The color of the flag matches EPA's Air Quality Index (AQI): green, yellow, orange, red, and purple. On unhealthy days, your organization can use this information to adjust physical activities to help reduce exposure to air pollution, while still keeping people active.
    1
    4 days ago
  • The Walkability Index dataset characterizes every Census 2019 block group in the U.S. based on its relative walkability. Walkability depends upon characteristics of the built environment that influence the likelihood of walking being used as a mode of travel. The Walkability Index is based on the EPA's previous data product, the Smart Location Database (SLD). Block group data from the SLD was the only input into the Walkability Index, and consisted of four variables from the SLD weighted in a formula to create the new Walkability Index. This dataset shares the SLD's block group boundary definitions from Census 2019. The methodology describing the process of creating the Walkability Index can be found in the documents located at https://edg.epa.gov/EPADataCommons/public/OA/WalkabilityIndex.zip. You can also learn more about the Smart Location Database at https://www.epa.gov/smartgrowth/smart-location-mapping.
    1
    4 days ago
  • These map layers present the number of National Green Building Standard points awarded for a project site or lot’s relative walkability, and accessibility to jobs via transit or within a 45-minute drive. This map presents information on the following criteria included in the 2020 National Green Building Standard: • Section 405.6(7) - Points for sites located in census block groups with above-average transit access to employment. (See variable D5b in Smart Location Database Technical Documentation and User Guide (2014) for background) • Section 405.6(8) - Points for sites located in census block groups with above-average access to employment within a 45-minute drive (See variable D5a in Smart Location Database Technical Documentation and User Guide (2014) for background on methods) • Section 501.2(4) - Points for lots located in census block groups with above-average neighborhood walkability (See National Walkability Index for background on methods) • Section 11.501.2(3) - Points for lots located in census block groups with above-average neighborhood walkability (See National Walkability Index for background on methods) Using data available through EPA’s Smart Location Database and National Walkability Index, relative walkability and accessibility to jobs via transit or within a 45-minute drive for census block groups were calculated and ranked into quartile groups. The regional comparison was made by considering the score of each individual census block group as a ratio of the average score of the county in which it is located. Those block groups with scores in the highest two quartiles nationally are eligible for NGBS points per the Sections noted above. Details on methodologies and datasets includes in the Smart Location Database and National Walkability Index can be found here: https://www.epa.gov/smartgrowth/smart-location-mapping#SLD
    1
    4 days ago
  • Jobs Within a 30-minute Transit and Walking Commute
    0
    4 days ago
  • A collection of performance indicators for consistently comparing neighborhoods (census block groups) across the US in regards to their accessibility to jobs or workers via public transit service. Accessibility was modeled by calculating total travel time between block group centroids inclusive of walking to/from transit stops, wait times, and transfers. Block groups that can be accessed in 30 minutes or less from the origin block group are considered accessible. Indicators reflect public transit service in December 2012 and employment/worker counts in 2010. Coverage is limited to census block groups within metropolitan regions served by transit agencies who share their service data in a standardized format called GTFS. All variable names refer to variables in EPA's Smart Location Database. For instance EmpTot10_sum summarizes total employment (EmpTot10) in block groups that are reachable within a 30-minute transit and walking commute. See Smart Location Database User Guide for full variable descriptions.
    1
    4 days ago
  • A collection of performance indicators and regional benchmarks for consistently comparing neighborhoods (census block groups) across the US in regards to their accessibility to jobs or workers via public transit service. Accessibility was modeled by calculating total travel time between block group centroids inclusive of walking to/from transit stops, wait times, and transfers. Block groups that can be accessed in 45 minutes or less from the origin block group are considered accessible. Indicators reflect public transit service in December 2012 and employment/worker counts in 2010. Coverage is limited to census block groups within metropolitan regions served by transit agencies who share their service data in a standardized format called GTFS.
    1
    4 days ago
  • A collection of performance indicators and regional benchmarks for consistently comparing neighborhoods (census block groups) across the US in regards to their accessibility to jobs or workers via public transit service. Accessibility was modeled by calculating total travel time between block group centroids inclusive of walking to/from transit stops, wait times, and transfers. Block groups that can be accessed in 45 minutes or less from the origin block group are considered accessible. Indicators reflect public transit service in December 2012 and employment/worker counts in 2010. Coverage is limited to census block groups within metropolitan regions served by transit agencies who share their service data in a standardized format called GTFS.
    1
    4 days ago
  • This web service contains the following layers: RMP, TRI, FRP, RCRATSD, CERCLIS, TSCA, and E-PLAN facilities and their associated CONTACTS, CHEMICALS, NAIP, SIC, and STATE IDs information. Layers are drawn at scale of 1: 18,489,297 and lower. Data used to create this web service are available as a separate download at the Secondary Linkage listed above. Full FGDC metadata records for each layer may be found by clicking the layer name in the web service table of contents (available through the online link provided above) and viewing the layer description. Data Dictionary available: https://ordsext.epa.gov/FLA/www3/ESF10_Supplemental_Metadata.docx
    0
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. These data are considered sensitive and are restricted to internal use only. The download file and map service are accessible only on the EPA intranet. EPA Category: Mission Sensitive, NARA Category: Critical Infrastructure.
    1
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. These data are considered sensitive and are restricted to internal use only. The download file and map service are accessible only on the EPA intranet. EPA Category: Mission Sensitive, NARA Category: Critical Infrastructure.
    1
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. These data are considered sensitive and are restricted to internal use only. The download file and map service are accessible only on the EPA intranet. EPA Category: Mission Sensitive, NARA Category: Critical Infrastructure.
    1
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. These data are considered sensitive and are restricted to internal use only. The download file and map service are accessible only on the EPA intranet. EPA Category: Mission Sensitive, NARA Category: Critical Infrastructure.
    1
    4 days ago
  • To improve public health and the environment, the United States Environmental Protection Agency (USEPA) collects information about facilities, sites, or places subject to environmental regulation or of environmental interest. These data are considered sensitive and are restricted to internal use only. The download file and map service are accessible only on the EPA intranet. EPA Category: Mission Sensitive, NARA Category: Critical Infrastructure.
    1
    4 days ago
  • This data layer represents all surface water features in the United States. This grid was created by combining water features identified in two sources, the 2019 National Land Cover Database (NLCD), and the National Hydrography Dataset (NHD Plus version 2.1). First, the surface water features were extracted from the 2019 NLCD produced by the Multi-Resolution Land Characteristics Consortium. Features included are 'Open Water' (code 11), 'Woody Wetlands' (code 90) and 'Emergent Herbaceous Wetlands' (code 95).The second source used was the flowline and waterbody features as represented in the catseed grid from the NHD Plus version 2.1. The combination of these two datasets represents surface water and is referred to as the 'Water Mask.' This dataset was produced by the US EPA to support research and online mapping activities related to the Watershed Index Online (WSIO) and EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The Riparian Zone Mask represents surface water in the United States and its estimated riparian zone. These areas were determined using grid analysis of an approximate 100 meter buffer placed around the combined surface water features of the 2019 National Land Cover Database (NLCD) produced by the Multi-Resolution Land Characteristics Consortium and the 1:100,000 scale National Hydrography Dataset (NHD) Plus version 2.1. Features from NLCD included are 'Open Water' (code 11), 'Woody Wetlands' (code 90) and 'Emergent Herbaceous Wetlands' (code 95). The combination of these two datasets and all cells with a distance of 108 meters or less from surface water are included in the Riparian Zone (RZ). This dataset was produced by the US EPA to support research and online mapping activities related to the Watershed Index Online (WSIO) and EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The Hydrologically Connected Zone (HCZ) Mask was determined using grid analysis to combine surface water features in the United States from three datasets: First, the surface water features were extracted from the 2019 National Land Cover Database (NLCD) produced by the Multi-Resolution Land Characteristics Consortium. Features included are 'Open Water' (code 11), 'Woody Wetlands' (code 90) and 'Emergent Herbaceous Wetlands' (code 95). Second, the flowline and waterbody features as represented in the catseed grid from the National Hydrography Dataset (NHD) Plus version 2.1. Third, all areas contiguous to surface water that also have a wetness index value of 550 or greater. The wetness index, also known as the compound topographic index (CTI), is a steady state wetness index. It is commonly used to quantify topographic control on hydrological processes. The combination of these three datasets represents the Hydrologically Connected Zone. This dataset was produced by the US EPA to support research and online mapping activities related to the Watershed Index Online (WSIO) and EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the annual average potential wind energy resource in kilowatt hours per square meter per day for each 12-digit Hydrologic Unit (HUC). It was produced using data from the National Renewable Energy Laboratory (NREL). These estimates represent wind resources at a 10 meter height above surface. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the approximate walking distance from a park entrance at any given location within the EnviroAtlas community boundary. The zones are estimated in 1/4 km intervals up to 1km then in 1km intervals up to 5km. Park entrances were included in this analysis if they were within 5km of the community boundary. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://enviroatlas.epa.gov/EnviroAtlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains Land Cover data by Wetness Index for each Watershed Boundary Dataset (WBD) 12-Digit Hydrologic Unit Code (HUC-12) of the conterminous United States, based on the National Land Cover Database (NLCD) from 2011, the December 30, 2009 Soil Survey Geographic (SSURGO) Database, and the USDA's Cropland Data Layer (CDL) data from 2011. The dataset includes the percentages of each HUC-12 belonging to several land cover groups that are on land with a Wetness Index greater than 550 (WET550). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The Washington DC EnviroAtlas Meter-scale Urban Land Cover (MULC) dataset comprises an area of 5423.43 km2 encompassing the entire area of Washington DC, and portions of the state of Maryland and state of Virginia. These MULC data and maps were derived from 1-m pixel, four-band (red, green, blue, and infrared light) leaf-on aerial photography acquired from the United States Department of Agriculture (USDA) National Agriculture Imagery Program (NAIP) as well as ancillary data (e.g., Lidar, National Wetlands Inventory [NWI], cropland, land parcels, power lines, building footprints). Eight land cover classes were mapped: Water, Impervious Surfaces, Soil/Barren, Trees/Forest, Grass/Herbaceous, Agriculture, Woody Wetlands and Emergent Wetlands. Wetlands were delineated using the state wide wetlands data from National Wetlands Inventory (NWI) layer updated on October 15, 2018 (https://www.fws.gov/wetlands/Data/State-Downloads.html ). An analysis of 600 completely random and 111 stratified random photo-interpreted land cover reference points yielded a simple overall user's accuracy (MAX) of 85.4% and an overall fuzzy user's accuracy (RIGHT) of 91.5% within the census block group boundary (see confusion matrices below). These data were developed as part of the Chesapeake Bay High-Resolution Land Cover Project, a cooperative agreement between the Chesapeake Conservancy and the National Park Service, funded through an interagency agreement with the Environmental Protection Agency (EPA). The Chesapeake Conservancy, under the direction of Margaret Markham, created the initial statewide 1-meter land cover data. EPA added agriculture and wetlands taken from ancillary data sources. See detailed processing steps and workflow below. This dataset was produced by the Chesapeake Conservancy, the National Park Service, and the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This data set is a complete digital hydrologic unit boundary layer to the Subwatershed (12-digit) 6th level for the entire United States. This data set consists of geo-referenced digital data and associated attributes created in accordance with the "Federal Guidelines, Requirements, and Procedures for the National Watershed Boundary Dataset; Chapter 3 of Section A, Federal Standards, Book 11, Collection and Delineation of Spatial Data; Techniques and Methods 11-A3" (04/01/2009). http://www.ncgc.nrcs.usda.gov/products/datasets/watershed/index.html . Polygons are attributed with hydrologic unit codes for 4th level sub-basins, 5th level watersheds, 6th level subwatersheds, name, size, downstream hydrologic unit, type of watershed, non-contributing areas and flow modification.
    1
    4 days ago
  • This EnviroAtlas dataset was produced by a joint effort of New Mexico State University, US Environmental Protection Agency (US EPA,) and the U.S. Geological Survey (USGS) to support research and online mapping activities related to EnviroAtlas. Ecosystem services, i.e., services provided to humans from ecological systems have become a key issue of this century in resource management, conservation planning, and environmental decision analysis. Mapping and quantifying ecosystem services have become strategic national interests for integrating ecology with economics to help understand the effects of human policies and actions and their subsequent impacts on both ecosystem function and human well-being. Some aspects of biodiversity are valued by humans in varied ways, and thus are important to include in any assessment that seeks to identify and quantify the benefits of ecosystems to humans. Some biodiversity metrics clearly reflect ecosystem services (e.g., abundance and diversity of harvestable species), whereas others may reflect indirect and difficult to quantify relationships to services (e.g., relevance of species diversity to ecosystem resilience, cultural and aesthetic values). Wildlife habitat has been modeled at broad spatial scales and can be used to map a number of biodiversity metrics. We map 15 biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for all vertebrate species except fish. Metrics include species richness for all vertebrates, specific taxon groups, harvestable species (i.e., upland game, waterfowl, furbearers, small game, and big game), threatened and endangered species, and state-designated species of greatest conservation need, and also a metric for ecosystem (i.e., land cover) diversity. This dataset contains information on Reptile Species Richness, the number of reptile species per 12-digit Hydrologic Unit (HUC). The EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the summed below ground live tree root dry biomass estimate by 12-digit Hydrologic Unit (HUC) in metric tons (megagrams) from the 2000 National Biomass and Carbon Dataset (Version 2.0) developed by the Woods Hole Research Center, released in October, 2012. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a summary of the thermoelectric water consumption based on the December 2016 US Energy Information Administration (EIA) monthly electric generator inventory, a 2014 review of water consumption for electricity generation (Macknick et al.), and reported water consumption estimates from a 2009 Department of Energy (DOE) report. The file contains total water withdrawal and consumption in gallons per year by 12-digit hydrologic unit codes (HUC_12s) from the boundary file named NHDPlusV2_WBDSnapshot_EnviroAtlas_CONUS. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual sediment yield in metric tons per hectare*10,000 to the nearest waterbody by each pixel for the conterminous United States for 2011 under a scenario in which natural vegetation has been removed. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual sediment yield in metric tons per hectare*10,000 to the nearest waterbody by each pixel for the conterminous United States for 2011 with existing land use / land cover. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual sediment yield in metric tons per hectare*10,000 to the nearest waterbody from each pixel avoided due to natural vegetation for the conterminous United States for 2011. It is the difference between sediment yield with existing land use / land cover and under a scenario in which natural vegetation has been removed. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains information about stressors in the upstream watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains information about stressors in the upstream catchments of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a point feature class showing the locations of stream confluences, with attributes showing indices of ecological integrity in the upstream catchments and watersheds of stream confluences and the results of a cluster analysis of these indices. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The annual average direct normal solar resources by 12-Digit Hydrologic Unit (HUC) was estimated from maps produced by the National Renewable Energy Laboratory for the U.S. Department of Energy (February 2009). The original data was from 10km, satellite modeled dataset (SUNY/NREL, 2007) representing data from 1998-2005. The 10km data was converted to 30m grid cells, and then zonal statistics were estimated for a final value of average kWh/m2/day for each 12-digit HUC. For more information about the original dataset please refer to the National Renewable Energy Laboratory (NREL) website at www.nrel.gov/gis/data_solar.html. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • SLD
    0
    4 days ago
  • This EnviroAtlas national dataset shows the average sediment delivery ratio (SDR) - the percentage of soil eroding from a pixel that is transported to a downstream water body - per pixel *1.0e4 for the conterminous United States for 2011 under a scenario in which natural vegetation has been removed. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average sediment delivery ratio (SDR) - the percentage of soil eroding from a pixel that is transported to a downstream water body - per pixel *1.0e4 for the conterminous United States for 2011 with existing land use / land cover. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual soil loss and sediment yield to waterbodies by 12-digit HUC subwatershed for the conterminous United States for 2011 with existing land use / land cover and under a scenario in which natural vegetation is removed. It also includes the soil loss and sediment yield prevented by natural vegetation, calculated as the difference between soil loss or sediment yield with existing land cover and under the vegetation removal scenario. This dataset is based on a collection of six rasters showing runoff, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual soil loss from each pixel avoided due to natural vegetation in metric tons per hectare*10,000 for the conterminous United States for 2011. It is the difference between soil loss with existing land use / land cover and under a scenario in which natural vegetation has been removed. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual soil loss from each pixel in metric tons per hectare*10,000 for the conterminous United States for 2011 under a scenario in which natural vegetation has been removed. This raster is part of a collection of eight rasters showing soil loss, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios, and the difference between both scenarios for soil loss and sediment yield. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national dataset shows the average annual soil loss from each pixel in metric tons per hectare*10,000 for the conterminous United States for 2011 with existing land use / land cover. This raster is part of a collection of six rasters showing runoff, sediment delivery ratio, and sediment yield to streams and waterbodies under two land cover scenarios. The two scenarios are the existing vegetation scenario based on the 2011 National Land Cover Database (NLCD), and a scenario in which natural land cover was replaced with barren land. Average annual soil loss due to sheet and rill erosion was calculated using the Revised Universal Soil Loss Equation (RUSLE) equation for both scenarios. A Sediment Delivery Ratio (SDR) was then applied to both scenarios. The SDR was multiplied by the average annual soil loss to estimate net sediment yield to downstream waterways under both scenarios. These datasets can be used together to quantify the soil retention services of natural vegetation. The datasets used as inputs include the 2011 NLCD, 1971-2000 Rainfall-runoff erosivity factor from PRISM (Parameter-elevation Regressions on Independent Slopes Model), the U.S. Geological Survey's 30-meter digital elevation model (DEM), Soil Survey Geographic Database (SSURGO), and State Soil Geographic Database (STATSGO2) data, MODIS (Moderate Resolution Imaging Spectroradiometer) Normalized Difference Vegetation Index (NDVI), and the US Department of Agriculture (USDA)'s crop management zones (CMZs). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as forest (excluding wetlands), forest including woody wetlands, and natural land cover that occurs within 45 meters of streams for each 12-digit hydrologic unit code (HUC) in Puerto Rico. Land cover is defined using the EnviroAtlas version of the Coastal Change Analysis Program's (C-CAP) 2010 layer for Puerto Rico and the 2012 C-CAP for the U.S. Virgin Islands. Steams were derived from the NHDPlus Version 2 dataset. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage land area that is classified as forest (excluding wetlands), forest including woody wetlands, and natural land cover that occurs within 45 meters of streams for each 12-digit hydrologic unit code (HUC) in Hawaii. Land cover is defined using the EnviroAtlas merged version of the Coastal Change Analysis Program's (C-CAP) 2005 - 2010 layer for Hawaii. Steams were derived from the NHDPlus Version 2 dataset. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as forest, forest including woody wetlands, and natural land cover that occurs within 45 meters of streams, rivers, and other hydrologically connected waterbodies within each 12-digit hydrologic unit code (HUC) in Alaska. Land cover is defined using the 2016 National Land Cover Dataset (NLCD). Streams were derived from the NHD (National Hydrography Dataset) High Resolution dataset obtained June 2020. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as tree canopy cover using the National Land Cover Database 2016 USFS Tree Canopy Cover dataset for each 12-digit hydrologic unit code (HUC) in Puerto Rico and the US Virgin Islands. Streams were derived from the National Hydrography Dataset (NHD) High Resolution dataset obtained June 2020. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as tree canopy cover using the National Land Cover Database 2016 USFS Tree Canopy Cover dataset for each 12-digit hydrologic unit code (HUC) in Hawaii. Streams were derived from the National Hydrography Dataset (NHD) High Resolution dataset obtained June 2020. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as tree canopy cover using the National Land Cover Database 2016 USFS Tree Canopy Cover dataset for each 12-digit hydrologic unit code (HUC) in the conterminous United States. Streams were derived from the National Hydrography Dataset (NHD) High Resolution dataset obtained June 2020. Datasets for other geographies were produced separately; metadata for these related datasets may be found here: Hawaii https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/RiparianCanopy_HI.xml, Puerto Rico and the U.S. Virgin Islands https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/RiparianCanopy_PRVI.xml. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the total number of vacant residential addresses for each Census Tract for each year from 2010-2014. Vacant buildings are included if they remained vacant for more than one year. Data were compiled from the United States Postal Service (USPS) Vacant Address Data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the vacancy rate for residential addresses for each Census Tract for each year from 2010-2014. Vacant buildings are included if they remained vacant for more than one year. Data were compiled from the United States Postal Service (USPS) Vacant Address Data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for reptile species, based on the number of reptile species as measured by predicted habitat present within a pixel. These metrics were created from grouping national level single species habitat models created by the USGS Gap Analysis Program into smaller ecologically based, phylogeny based, or stakeholder suggested composites. The dataset includes reptile species richness metrics for all reptile species, lizards, snakes, turtles, poisonous reptiles, Natureserve-listed G1,G2, and G3 reptile species, and reptile species listed by IUCN (International Union for Conservation of Nature), PARC (Partners in Amphibian and Reptile Conservation) and SWPARC (Southwest Partners in Amphibian and Reptile Conservation). This dataset was produced by a joint effort of New Mexico State University, US EPA, and USGS to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for reptile species, based on the number of reptile species as measured by predicted habitat present within a pixel. These metrics were created from grouping national level single species habitat models created by the USGS Gap Analysis Program into smaller ecologically based, phylogeny based, or stakeholder suggested composites. The dataset includes reptile species richness metrics for all reptile species, lizards, snakes, turtles, poisonous reptiles, Natureserve-listed G1,G2, and G3 reptile species, and reptile species listed by IUCN (International Union for Conservation of Nature), PARC (Partners in Amphibian and Reptile Conservation) and SWPARC (Southwest Partners in Amphibian and Reptile Conservation). This dataset was produced by a joint effort of New Mexico State University, US EPA, and USGS to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas). This web service includes the State, County, and Census Block Groups boundaries from the TIGER shapefiles compiled into a single national coverage for each layer. The TIGER/Line Files are shapefiles and related database files (.dbf) that are an extract of selected geographic and cartographic information from the U.S. Census Bureau's Master Address File / Topologically Integrated Geographic Encoding and Referencing (MAF/TIGER) Database (MTDB).
    1
    4 days ago
  • This EnviroAtlas dataset identifies rare ecosystems using base landcover data from the USGS GAP Analysis Program (Version 2, 2011) combined with landscape ecology principles. This raster dataset represents an index of rarity ranging from 0 (common) to 100 (rare). EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The EnviroAtlas Potential Wetland Areas (PWA) dataset shows potential wetland areas at 30-meter resolution. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Wetland restoration could help restore these benefits. Potential wetland areas, as developed for this map, are lands that naturally accumulate water due to topography and have historically had poorly or very poorly draining soils. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a digital hydrologic unit (HUC) boundary layer to the Subwatershed (12-digit) 6th level for Puerto Rico, based on the May 2016 NHDPlus V2.1 WBD (Watershed Boundary Dataset) Snapshot for Puerto Rico & U.S. Virgin Islands. Information on the percent land area has been added, and HUCs for Puerto Rico and the Virgin Islands have been split into two separate files. The location of one HUC (a small island) has been adjusted to align with aerial imagery and GAP (Gap Analysis Program) land cover data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a digital hydrologic unit (HUC) boundary layer to the Subwatershed (12-digit) 6th level for Puerto Rico, based on the May 2016 NHDPlus V2.1 WBD (Watershed Boundary Dataset) Snapshot for Puerto Rico & U.S. Virgin Islands. Information on the percent land area has been added, and HUCs for Puerto Rico and the Virgin Islands have been split into two separate files. The location of one HUC (a small island) has been adjusted to align with aerial imagery and GAP (Gap Analysis Program) land cover data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    0
    4 days ago
  • The EnviroAtlas Potentially Restorable Wetlands on Agricultural Land (PRW-Ag) dataset shows potentially restorable wetlands at 30-meter resolution. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Wetland restoration could help restore these benefits. Potentially restorable wetlands, as developed for this map, are lands currently in agriculture that naturally accumulate water due to topography and have historically had poorly or very poorly draining soils. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset shows the percentage of each National Hydrography Dataset Plus (NHDPlus) V2 12-digit Hydrologic Unit (HUC) that is included in the USGS National Gap Analysis Program (GAP) or International Union for the Conservation of Nature (IUCN) protection categories in the Protected Areas Database of the United States (PADUS). Percentages for GAP status 1 and 2 combined, GAP status 3, and GAP status 1, 2, and 3 combined are provided. The percentages for IUCN categories Ia, Ib, II, III, IV, V, and VI are provided, as well as for all the categories combined. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset shows the percentage of each National Hydrography Dataset Plus (NHDPlus) V2 12-digit Hydrologic Unit (HUC) that is included in the USGS National Gap Analysis Program (GAP) or International Union for the Conservation of Nature (IUCN) protection categories in the Protected Areas Database of the United States (PADUS). Percentages for GAP status 1 and 2 combined, GAP status 3, and GAP status 1, 2, and 3 combined are provided. The percentages for IUCN categories Ia, Ib, II, III, IV, V, and VI are provided, as well as for all the categories combined. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset shows the percentage of each National Hydrography Dataset Plus (NHDPlus) V2 12-digit Hydrologic Unit (HUC) that is included in the USGS National Gap Analysis Program (GAP) or International Union for the Conservation of Nature (IUCN) protection categories in the Protected Areas Database of the United States (PADUS). Percentages for GAP status 1 and 2 combined, GAP status 3, and GAP status 1, 2, and 3 combined are provided. The percentages for IUCN categories Ia, Ib, II, III, IV, V, and VI are provided, as well as for all the categories combined. Datasets for other geographies were produced separately; metadata for these related datasets may be found here: Alaska https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/Protection_AK.xml, Hawaii https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/Protection_HI.xml, Puerto Rico and the U.S. Virgin Islands https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/Protection_PRVI.xml This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset shows the percentage of each Watershed Boundary Dataset (WBD) 12-digit Hydrologic Unit (HUC) that is included in the USGS National Gap Analysis Program (GAP) or International Union for the Conservation of Nature (IUCN) protection categories in the Protected Areas Database of the United States (PADUS). Percentages for GAP status 1 and 2 combined, GAP status 3, and GAP status 1, 2, and 3 combined are provided. The percentages for IUCN categories Ia, Ib, II, III, IV, V, and VI are provided, as well as for all the categories combined. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows potentially restorable wetlands at 30 meter resolution. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Potentially restorable wetlands for this map are lands currently in agriculture that naturally accumulate water and historically had poor drainage and hydric soils. By restoring some of these wetlands, it is hoped that the benefits of wetlands would also be restored. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset estimates population by 12-digit HUC. It is based on the EnviroAtlas dasymetric dataset, which intelligently reallocates 2010 population from census blocks to 30 meter pixels based on land cover and slope. The dasymetric data was aggregated by HUC_12 boundary to summarize population by watershed. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset is a summary of crop acres without nearby pollinator habitat. Pollination habitat here is defined as trees (fruit, nut, deciduous, and evergreen). Crops are only those that either benefit from or require pollinators in order to produce or improve crop production. The maximum distance a tree habitat could be from the crop pixel was 2.8 km. If the crop had no tree habitat within this distance (euclidean) then it was selected as needing habitat. The total areas of crops without nearby pollinator habitat was then summed by 12 digit HUCS. This metric is a measure of demand for pollinators in order to improve or produce crop yields. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the approximate walking distance from a park entrance at any given location within the EnviroAtlas community boundary. The zones are estimated in 1/4 km intervals up to 1km then in 1km intervals up to 5km. Park entrances were included in this analysis if they were within 5km of the community boundary. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://enviroatlas.epa.gov/EnviroAtlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains information about physical characteristics, such as temperature, elevation, and precipitation, in the upstream watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains information about physical characteristics, such as temperature, elevation, and precipitation, in the upstream catchments of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset estimates the percent urban land for each 12-digit hydrologic unit code (HUC) in the conterminous United States. For the purposes of this map, urban land cover includes a variety of development, such as open spaces, parks, golf courses, single family homes, multifamily housing units, retail, commercial, industrial sites, and associated infrastructure. Urban land cover is not confined to city limits. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the percent land cover with potentially restorable wetlands on agricultural land for each 12-digit Hydrologic Unit (HUC) watershed in the contiguous U.S. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Wetland restoration could help restore these benefits. Potentially restorable wetlands, as developed for this map, are lands currently in agriculture that naturally accumulate water due to topography and have historically had poorly or very poorly draining soils. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the percent of each 12-digit Hydrologic Unit (HUC) subwatershed in the contiguous U.S. with potentially restorable wetlands. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Potentially restorable wetlands for this map are lands currently in agriculture that naturally accumulate water and historically had poor drainage and hydric soils. By restoring some of these wetlands, it is hoped that the benefits of wetlands would also be restored. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area within each 12-digit hydrologic unit code (HUC) in Puerto Rico and the US Virgin Islands that is classified as tree canopy using the National Land Cover Database 2016 (NLCD2016) USFS Tree Canopy Cover (Puerto Rico) dataset. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area within each 12-digit hydrologic unit code (HUC) in Hawaii that is classified as tree canopy using the National Land Cover Database 2016 (NLCD2016) USFS Tree Canopy Cover (Hawaii) dataset. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area within each 12-digit hydrologic unit code (HUC) in the conterminous United States (CONUS) that is classified as tree canopy using the National Land Cover Database 2016 (NLCD2016) U.S. Forest Service (USFS) Tree Canopy Cover dataset (CONUS). Datasets for other geographies were produced separately; metadata for these related datasets may be found here: Hawaii https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/PCanopy_HI.xml, Puerto Rico and the U.S. Virgin Islands https://enviroatlas.epa.gov/enviroatlas/MetadataFGDC/PCanopy_PRVI.xml. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains annual (2002) simulated estimations of edge-of-field agricultural nitrogen (N) and phosphorus (P) lost in surface runoff, subsurface flow (tile and non-tile) and percolate, N and P attached to eroding soil (sediment loss) and associated surface, subsurface and vertical water flow and surface soil erosion. The dataset was generated using Weather Research Forecast (WRF) modeled weather, Community Multi-Scale Air Quality (CMAQ) model deposition and the Environmental Policy Integrated Climate (EPIC) model as implemented under the Fertilizer Emission Scenario Tool for CMAQ (FEST-C), all run for 12-km rectangular grids across the continental US. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset describes the non-native freshwater aquatic diversity by 12-digit HUC (subwatershed) for the conterminous United States. It includes animals and plants. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a summary of the National Dams Inventory data from 2009 survey. The file contains counts of inventoried dams by 12-digit hydrologic units codes (March 2011) and total maximum storage capacity in millions of gallons. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a digital hydrologic unit boundary layer to the Subwatershed (12-digit) 6th level for the conterminous United States, based on the January 6, 2015 NHDPlus V2 WBD (Watershed Boundary Dataset) Snapshot (NHDPlusV21_NationalData_WBDSnapshot_FileGDB_05). The feature class has been edited for use in for EPA ORD's EnviroAtlas. Features in Canada and Mexico have been removed, the boundaries of three 12-digit HUCs have been edited to eliminate gaps and overlaps, the dataset has been dissolved on HUC_12 to create multipart polygons, and information on the percent land area has been added. Hawaii, Puerto Rico, and the U.S. Virgin Islands have been removed, and can be downloaded separately. Other than these modifications, the dataset is the same as the WBD Snapshot included in NHDPlus V2. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service contains layers depicting hydrologic unit boundary layers and labels for the Subregion level (4-digit HUCs), Subbasin level (8-digit HUCs), and Subwatershed level (12-digit HUCs) for the conterminous United States. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service contains layers depicting NHD Version 2.1 Plus flowlines and waterbodies for the conterminous United States. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a summary of total population near major roads without any tree buffer within 12-digit Hydrologic Units (HUC_12), based on the National Land Cover Database 2011 (NLCD 2011) percent tree canopy cover (TCC 2011) dataset. The metric is a measure of potential exposure to particulate matter from exhaust from traffic. Studies have shown that tree buffers can help improve air quality by filtering particulate matter for those living or working near roads. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the approximate walking distance from a park entrance at any given location within the EnviroAtlas community boundary. The zones are estimated in 1/4 km intervals up to 1km then in 1km intervals up to 5km. Park entrances were included in this analysis if they were within 5km of the community boundary. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://enviroatlas.epa.gov/EnviroAtlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset demonstrates the effect of changes in pollution concentration on local populations in 128 block group in New Bedford, Massachusetts. The US EPA's Environmental Benefits Mapping and Analysis Program (BenMAP) was used to estimate the incidence of adverse health effects (i.e., mortality and morbidity) and associated monetary value that result from changes in pollution concentrations for Cuyahoga, Geauga, Lake, Lorain, Medina, Portage, and Summit Counties, OH. Incidence and value estimates for the block groups are calculated using i-Tree models (www.itreetools.org), local weather data, pollution data, and U.S. Census derived population data. This dataset was produced by the USDA Forest Service with support from The Davey Tree Expert Company to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes analysis by NatureServe of species that are Imperiled (G1/G2) or Listed under the U.S. Endangered Species Act (ESA) by 12-digit Hydrologic Units (HUCs). The analysis results are for use and publication by both the LandScope America website and by the EnviroAtlas. Results are provided for the total number of Aquatic Associated G1-G2/ESA species, the total number of Wetland Associated G1-G2/ESA species, the total number of Terrestrial Associated G1-G2/ESA species, and the total number of Unknown Habitat Association G1-G2/ESA species in each HUC12. NatureServe is a non-profit organization dedicated to developing and providing information about the world's plants, animals, and ecological communities. NatureServe works in partnership with 82 independent Natural Heritage programs and Conservation Data Centers that gather scientific information on rare species and ecosystems in the United States, Latin America, and Canada (the Natural Heritage Network). NatureServe is a leading source for biodiversity information that is essential for effective conservation action. This dataset was produced by NatureServe to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset describes the native freshwater aquatic biodiversity by 12-digit HUC (subwatershed) for the conterminous United States. It includes amphibians, fish, mollusks, decapods, and turtles. The metrics are: total species richness; count of threatened and endangered species; a rarity index; and a native vulnerability index. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas). This web service includes layers depicting EnviroAtlas national metrics mapped at the 12-digit HUC within the conterminous United States. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains the percentage of small, medium, and large natural areas for each Watershed Boundary Dataset (WBD) 12-Digit Hydrologic Unit Code (HUC-12) of the conterminous United States that is considered Natural based on the National Land Cover Database (NLCD). The percentage of natural area is by size class: Small is <500 acres, Medium is 500-25,000 acres, and Large is > 25,000 acres. Natural land cover combines NLCD-CDL 63, 83, 87, 111, 112, 131, 141, 142, 143, 151, 152, 171, 190, 195. This dataset was produced by the Tetra Tech, Inc. to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • These layers are a selection of the National Air Toxics Assessment (NATA) 2014 estimates of ambient concentrations and health-effect results by 2010 U.S. Census Tract. The Environmental Protection Agency (EPA) developed NATA as a screening tool to identify potential health risks from toxic air pollutants for further study. Please see NATA's website (https://www.epa.gov/national-air-toxics-assessment) for information about using NATA. This dataset is based on data from 2014 NATA, which was produced by the US EPA to estimate health risks from toxic air pollutants. It was modified for incorporation into the Compare my Area tool. The NATA results are available as downloadable data from https://www.epa.gov/national-air-toxics-assessment/2014-nata-assessment-results.
    1
    4 days ago
  • These layers are a selection of the National Air Toxics Assessment (NATA) 2014 estimates of ambient concentrations and health-effect results by state. The Environmental Protection Agency (EPA) developed NATA as a screening tool to identify potential health risks from toxic air pollutants for further study. Please see NATA's website (https://www.epa.gov/national-air-toxics-assessment) for information about using NATA. This dataset is based on data from 2014 NATA, which was produced by the US EPA to estimate health risks from toxic air pollutants. It was modified for incorporation into the Compare my Area tool. The NATA results are available as downloadable data from https://www.epa.gov/national-air-toxics-assessment/2014-nata-assessment-results.
    1
    4 days ago
  • These layers are a selection of the National Air Toxics Assessment (NATA) 2014 estimates of ambient concentrations and health-effect results by 2010 counties. The Environmental Protection Agency (EPA) developed NATA as a screening tool to identify potential health risks from toxic air pollutants for further study. Please see NATA's website (https://www.epa.gov/national-air-toxics-assessment) for information about using NATA. This dataset is based on data from 2014 NATA, which was produced by the US EPA to estimate health risks from toxic air pollutants. It was modified for incorporation into the Compare my Area tool. The NATA results are available as downloadable data from https://www.epa.gov/national-air-toxics-assessment/2014-nata-assessment-results.
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as missing in this dataset; waterbodies are masked out and not included in the analysis with the development and natural land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as missing in this dataset; waterbodies are masked out and not included in the analysis with the development and natural land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as foreground in this dataset; waterbodies are included with core natural areas and included in the analysis with the natural land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as foreground in this dataset; waterbodies are included with core natural areas and included in the analysis with the natural land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as background in this dataset; waterbodies are separated from the natural land cover classes and included in the analysis with the developed land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset categorizes land cover into structural elements (e.g. core, edge, connector, etc.). It depicts core areas of natural land cover, core fragmentation, and patterns of connectivity among core patches. Water is treated as background in this dataset; waterbodies are separated from the natural land cover classes and included in the analysis with the developed land cover classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the total number of recreational days per year demanded by people ages 18 and over for migratory bird hunting by location in the contiguous United States. These values are based on 2010 population distribution, 2011 U.S. Fish and Wildlife Service (FWS) Fish, Hunting, and Wildlife-Associated Recreation (FHWAR) survey data, and 2011 U.S. Department of Agriculture (USDA) Forest Service National Visitor Use Monitoring program data, and have been summarized by 12-digit hydrologic unit code (HUC). This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national map displays the application rate of phosphorus (P) as manure on croplands in the conterminous United States (excluding Hawaii and Alaska) for the year 2012 by 12-digit HUC. These data are based on county-level data on P as recoverable manure from concentrated animal feeding operations (CAFOs) from the International Plant Nutrition Institute (IPNI) and cropland area from the USGS's U.S. conterminous wall-to-wall anthropogenic land use trends (NWALT) 2012 land cover data. These are thus not actual application rates but rather estimated rates based on the production of recoverable manure and the amount of agricultural lands close by. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains data on the mean livestock manure application to cultivated crop and hay/pasture lands by 12-digit Hydrologic Unit (HUC) in 2006. Livestock manure inputs to cultivated crop and hay/pasture lands were estimated using county-level estimates of recoverable animal manure from confined feeding operations compiled for 2007. Recoverable manure is defined as manure that is collected, stored, and available for land application from confined feeding operations. County-scale data on livestock populations -- needed to calculate manure inputs -- were only available for the year 2007 from the USDA Census of Agriculture (http://www.agcensus.usda.gov/index.php). We acquired county-level data describing total farm-level inputs (kg N/yr) of recoverable manure to individual counties in 2007 from the International Plant Nutrition Institute (IPNI) Nutrient Geographic Information System (NuGIS; http://www.ipni.net/nugis). These data were converted to per area rates (kg N/ha/yr) of manure N inputs by dividing the total N input by the land area (ha) of combined cultivated crop and hay/pasture (agricultural) lands within a county as determined from county-level summarization of the 2006 NLCD. We distributed county-specific, per area N inputs rates to cultivated crop and hay/pasture lands (30 x 30 m pixels) within the corresponding county. Manure data described here represent an average input to a typical agricultural land type within a county, i.e., they are not specific to individual crop types. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains changes in land cover proportions between 2001 and 2011 for the upstream watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains changes in land cover proportions between 2001 and 2011 for the upstream catchments of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains land cover proportions for the upstream watersheds of stream confluences for 2011. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains land cover proportions for the upstream catchments of stream confluences for 2011. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains land cover proportions for the upstream watersheds of stream confluences for 2001. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains land cover proportions for the upstream catchments of stream confluences for 2001. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover using the EnviroAtlas version of the 2010 and 2012 Coastal Change Analysis Program (C-CAP) land cover datasets for the US Virgin Islands and Puerto Rico for each 12-digit hydrologic unit code (HUC). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover using the EnviroAtlas composite of the 2005-2011 Coastal Change Analysis Program (C-CAP) land cover dataset for each 12-digit hydrologic unit code (HUC) in Hawaii. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover as well as those labeled tundra, shrubland, herbaceous, and perennial snow/ice using the 2016 National Land Cover Dataset (NLCD) for each 12-digit hydrologic unit code (HUC) in Alaska. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The Los Angeles County, CA Meter Urban Land Cover (MULC) dataset was generated from sub-meter image pixel resolution data created by the University of Vermont Spatial Analysis Laboratory (SAL) through the combined use of 2016 USDA National Agricultural Imagery Program (NAIP) four band (red, green, blue and near infrared) aerial imagery, 2016 LiDAR data and 2014 ortho-imagery. The sub-meter, thematic landcover data feature attributes were recoded and spatially resampled to a 1-meter spatial scale by EPA for MULC data product integration. The mapped area is confined to the boundaries of US Census Bureau's 2010 Urban Statistical Area for Los Angeles County, with an added 1km coastal water buffer area extension. The following eight land cover classes were mapped: Water, Impervious, Soil or Barren, Trees or Forest, Grass or Herbaceous, Woody Wetlands and Emergent Wetlands. Integrated wetland features were derived using ancillary National Wetlands Inventory (NWI) polygon data (version 2), downloaded from the Unites States Fish and Wildlife Service (USFWS) Wetland Mapper web mapping service (https://www.fws.gov/wetlands/data/mapper.html). Metadata for the NWI wetlands data layer can be found at http://www.fws.gov/wetlands/Data/Metadata.html. An accuracy assessment of the classified product, using 887 completely random and 40 stratified random photo-interpreted land cover reference sample points yielded an overall user's accuracy (MAX) of 61.1 percent and a fuzzy user's accuracy (RIGHT) of 89.2 percent. For data workflow processing details see Overview Description section. This dataset was produced by the University of Vermont Spatial Analysis Laboratory, the United States Forest Service Urban Tree Canopy (UTC) assessment program, and the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes industrial water demand attributes which provide insight into the amount of water currently used for manufacturing and production of commodities in the contiguous United States. The values are based on 2010 water demand and Dun and Bradstreet's 2009/2010 source data, and have been summarized by watershed or 12-digit hydrologic unit code (HUC). For the purposes of this metric, industrial water use includes chemical, food, paper, wood, and metal production. The industrial water is for self-supplied only such as by private wells or reservoirs. Sources include either surface water or groundwater. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the percentage of population within different household income ranges for each Census Block Group (CBG), a threshold estimated to be an optimal household income for quality of life, and the percentage of households with income below this threshold. Data were compiled from the Census ACS (American Community Survey) 5-year Summary Data (2008-2012). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset depicts the total length of stream or river flowlines that have impairments submitted to the EPA by states under section 303(d) of the Clean Water Act. It also contains the total lengths of streams, rivers, and canals, total waterbody area, and stream density (stream length per area) from the US Geological Survey's high-resolution National Hydrography Dataset (NHD). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the percentages of stream and water body shoreline lengths within 30 meters of impervious cover by 12-digit Hydrologic Unit (HUC) subwatershed in the contiguous U.S. Impervious cover alters the hydrologic behavior of streams and water bodies, promoting increased storm water runoff and lower stream flow during periods in between rainfall events. Impervious cover also promotes increased pollutant loads in receiving waters and degraded streamside habitat. This dataset shows were impervious cover occurs close to streams and water bodies, where it is likely to have a greater adverse impact on receiving waters. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains information about hydrologic attributes of the upstream catchments and watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the total number of historic places located within each 12-digit Hydrologic Unit (HUC). The historic places data were compiled from the National Park Service's National Register of Historic Places (NRHP), which provides official federal lists of districts, sites, buildings, structures and objects significant to American history, architecture, archeology, engineering, and culture. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the number of major grains grown, yield in tons, and area in hectares for several major grains and for cotton by 12-digit Hydrologic Unit (HUC). It is based on the United States Department of Agriculture's 2010 Cropland Data Layer (CDL) and data on yields and sales from the National Agricultural Statistics Service (NASS). The grains included in this dataset are corn, barley, cotton, durum wheat, oats, rye, rice, sorghum, spring wheat, soybeans, and winter wheat; it does not include data on every grain. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains indices of geologic (lithosphere) conditions in the upstream watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains indices of geologic (lithosphere) conditions in the upstream catchments of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset demonstrates the effect of changes in pollution concentration on local populations in 155 block groups in Green Bay, Wisconsin. The US EPA's Environmental Benefits Mapping and Analysis Program (BenMAP) was used to estimate the incidence of adverse health effects (i.e., mortality and morbidity) and associated monetary value that result from changes in pollution concentrations for Cuyahoga, Geauga, Lake, Lorain, Medina, Portage, and Summit Counties, OH. Incidence and value estimates for the block groups are calculated using i-Tree models (www.itreetools.org), local weather data, pollution data, and U.S. Census derived population data. This dataset was produced by the USDA Forest Service with support from The Davey Tree Expert Company to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas data set depicts estimates for mean cash rent paid for land by farmers, sorted by county for irrigated cropland, non-irrigated cropland, and pasture by for most of the conterminous US. This data comes from national surveys which includes approximately 240,000 farms and applies to all crops. According to the USDA (U.S. Department of Agriculture) National Agricultural Statistics Service (NASS), these surveys do not include land rented for a share of the crop, on a fee per head, per pound of gain, by animal unit month (AUM), rented free of charge, or land that includes buildings such as barns.  For each land use category with positive acres, respondents are given the option of reporting rent per acre or total dollars paid. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the total number of recreational days per year demanded by people ages 18 and over for freshwater fishing by location in the contiguous United States. These values are based on 2010 population distribution, 2011 U.S. Fish and Wildlife Service (FWS) Fish, Hunting, and Wildlife-Associated Recreation (FHWAR) survey data, and 2011 U.S. Department of Agriculture (USDA) Forest Service National Visitor Use Monitoring program data, and have been summarized by 12-digit hydrologic unit code (HUC). This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national map displays the application rate of inorganic phosphorus (P) fertilizer on agricultural land in the conterminous United States (excluding Hawaii and Alaska) for the year 2012 by 12-digit HUC. These data are based on International Plant Nutrition Institute (IPNI) compilations of county and state fertilizer sales for 2012 and cropland area from the USGS's U.S. conterminous wall-to-wall anthropogenic land use trends (NWALT) 2012 land cover data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains data on the mean synthetic nitrogen (N) fertilizer application to cultivated crop and hay/pasture lands per 12-digit Hydrologic Unit (HUC) in 2006. Synthetic N fertilizer inputs in 2006 were estimated using county-level estimates of farm N fertilizer inputs. We acquired county-level data describing total farm-level inputs (kg N/yr) of synthetic N fertilizer to individual counties in 2006 from the United States Geological Survey (USGS) (http://pubs.usgs.gov/sir/2012/5207/). These data were converted to per area rates (kg N/ha/yr) of synthetic N fertilizer application by dividing the total N input by the land area (ha) of combined cultivated crop and hay/pasture lands within a county as determined from county-level (http://cta.ornl.gov/transnet/Boundaries.html) summarization of the 2006 National Land Cover Database (NLCD; http://www.mrlc.gov/nlcd06_data.php). We distributed county-specific, annual per area N inputs rates (kg N/ha/yr) to cultivated crop and hay/pasture lands (30 x 30 m pixels) within the corresponding county using the raster calculator tool in ArcMap 10.0 (ESRI, Inc., Redlands, CA). Fertilizer data described here represent an average input to a typical agricultural land type within a county, i.e., they are not specific to individual crop types. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains a count of the number of local farmers markets within each subwatershed (12-digit HUC) based on their location given within the USDA National Farmers Market Directory (https://www.ams.usda.gov/local-food-directories/farmersmarkets). This data has been processed from the original directory to remove duplicate locations, as well as a small subsample (25 markets) were corrected by hand in order avoid duplication across block group boundaries. This dataset is contemporary as of 5/20/2016, and downloaded from the USDA Agricultural Marketing Service (AMS) website. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains a count of the number of local farmers markets within each census block group (CBG) based on their location given within the USDA National Farmers Market Directory (https://www.ams.usda.gov/local-food-directories/farmersmarkets). This data has been processed from the original directory to remove duplicate locations, as well as a small subsample (25 markets) were corrected by hand in order avoid duplication across block group boundaries. This dataset is contemporary as of 5/20/2016, and downloaded from the USDA Agricultural Marketing Service (AMS) website. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • Understanding the relationship between flood inundation and floodplains is critical for ecosystem and community health and well-being, as well as targeting floodplain and riparian restoration. Many communities in the United States, particularly those in rural areas, lack inundation maps due to the high cost of flood modeling. Only 60% of the conterminous United States has Flood Insurance Rate Maps (FIRMs) through the U.S. Federal Emergency Management Agency (FEMA). This EnviroAtlas dataset provides an estimate of the 100-year floodplain for the conterminous United States at 30-meter resolution to fill the gaps in the FIRM. The model hit rate for the CONUS was 0.79 compared to the FIRM, indicating that the model captured 79% of the 100-year floodplain identified by FEMA. This product provides complete coverage for the CONUS by identifying floodplains in areas without FIRMs, while also identifying floodplains in tributaries sometimes excluded by FEMA. More information can be found in the journal article (https://doi.org/10.1016/j.scitotenv.2018.07.353). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas). The EnviroAtlas Potential Wetland Areas (PWA) dataset shows potential wetland areas at 30-meter resolution. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Wetland restoration could help restore these benefits. Potential wetland areas, as developed for this map, are lands that naturally accumulate water due to topography and have historically had poorly or very poorly draining soils. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas). The EnviroAtlas Potentially Restorable Wetlands on Agricultural Land (PRW-Ag) dataset shows potentially restorable wetlands at 30-meter resolution. Beginning two centuries ago, many wetlands were turned into farm fields or urban areas, yet wetlands play an important role in removing water pollution, regulating water storage and flows, and providing habitat for wildlife. Wetland restoration could help restore these benefits. Potentially restorable wetlands, as developed for this map, are lands currently in agriculture that naturally accumulate water due to topography and have historically had poorly or very poorly draining soils. This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service includes maps that illustrate the number and density of housing units. Housing density and the proximity of housing to employment can affect commuting patterns. Housing located near jobs can reduce commute time and allow for a greater variety of commute modes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service includes maps that illustrate job activity in each census block group. Employment diversity, employment density, and proximity of employment to housing can affect commuting patterns. Having plentiful and diverse jobs located near housing can reduce commute time and allow for a greater variety of commute modes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service includes maps that illustrate population and residential activity in each census block group as well as residential-location-based socioeconomic variables. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service includes maps that illustrate factors affecting transit accessibility, and indicators of accessibility. Accessibility measures how easily people can reach destinations such as their workplaces and can be measured in terms of both time and distance. It is affected by factors such as the proximity of housing to jobs, transit stops, stores, and services; the availability of various transit modes; and land use patterns. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the employment rate, or the percent of the population aged 16-64 who have worked in the past 12 months. The employment rate is a measure of the percent of the working-age population who are employed. It is an indicator of the prevalence of unemployment, which is often used to assess labor market conditions by economists. It is a widely used metric to evaluate the sustainable development of communities (NRC, 2011, UNECE, 2009). This dataset is based on the American Community Survey 5-year data for 2008-2012. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset identifies rare ecosystems using base landcover data from the USGS GAP Analysis Program (Version 2, 2011) combined with landscape ecology principles. The metrics included in this data set identify total rare acres and the protected rare acres within each 12-digit Hydrologic Unit (HUC). The percentage of the terrestrial area of each HUC covered by rare ecosystems as well as the percent of rare acres that are protected are also included. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas web service contains layers depicting market-based programs and projects addressing ecosystem services protection in the United States. Layers include data collected via surveys and desk research conducted by Forest Trends' Ecosystem Marketplace from 2008 to 2016 on biodiversity (i.e., imperiled species/habitats; wetlands and streams), carbon, and water markets and enabling conditions that facilitate, directly or indirectly, market-based approaches to protecting and investing in those ecosystem services. This dataset was produced by Forest Trends' Ecosystem Marketplace for EnviroAtlas in order to support public access to and use of information related to environmental markets. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains polygons depicting the number of watershed-level market-based programs, referred to herein as markets, in operation per 8-digit HUC watershed throughout the United States. The data were collected via surveys and desk research conducted by Forest Trends' Ecosystem Marketplace during 2014 regarding markets operating to protect watershed ecosystem services. Utilizing these data, the number of water market coverage areas overlaying each HUC8 watershed were calculated to produce this dataset. Only water markets identified as operating at the watershed level (i.e., single or multiple watersheds define the market boundaries) were included in the count of water markets per HUC8 watershed. Excluded were water markets operating at the national, state, county, or federal lands level and all water projects. Attribute data include the watershed's 8-digit hydrologic unit code and name, in addition to the watershed-level water market count associated with the watershed. This dataset was produced by Forest Trends' Ecosystem Marketplace to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains polygons depicting conditions enabling market-based programs, referred to herein as markets, and projects addressing ecosystem services protection in the United States. Polygons represent the area in which a particular condition, policy, or regulation is implemented with the result of direct or indirect facilitation of a market-based approach to investing in and protecting biodiversity (i.e., imperiled species/habitats; wetlands and streams), carbon, and/or water ecosystem services. The data were collected via desk research conducted by Forest Trends' Ecosystem Marketplace during 2015-2016. Attribute data include the ecosystem service(s) of interest, year established, design mechanisms(s) employed, and the regulatory authority associated with a particular condition. This dataset was produced by Forest Trends' Ecosystem Marketplace for Enviroatlas in order to support public access to and use of information related to environmental markets. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains polygons depicting the geographic areas of market-based programs, referred to herein as markets, and projects addressing ecosystem services protection in the United States. Depending upon the type of market or project and data availability, polygons reflect market coverage areas, project footprints, or project primary impact areas in which ecosystem service markets and projects operate. The data were collected via surveys and desk research conducted by Forest Trends' Ecosystem Marketplace from 2008 to 2016 on biodiversity (i.e., imperiled species/habitats; wetlands and streams), carbon, and water markets. Additional biodiversity data were obtained from the Regulatory In-lieu Fee and Bank Information Tracking System (RIBITS) database in 2015. Attribute data include information regarding the methodology, design, and development of biodiversity, carbon, and water markets and projects. This dataset was produced by Forest Trends' Ecosystem Marketplace for EnviroAtlas in order to support public access to and use of information related to environmental markets. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains points depicting the location of market-based programs, referred to herein as markets, and projects addressing ecosystem services protection in the United States. The data were collected via surveys and desk research conducted by Forest Trends' Ecosystem Marketplace from 2008 to 2016 on biodiversity (i.e., imperiled species/habitats; wetlands and streams), carbon, and water markets. Additional biodiversity data were obtained from the Regulatory In-lieu Fee and Bank Information Tracking System (RIBITS) database in 2015. Points represent the centroids (i.e., center points) of market coverage areas, project footprints, or project primary impact areas in which ecosystem service markets or projects operate. National-level markets are an exception to this norm with points representing administrative headquarters locations. Attribute data include information regarding the methodology, design, and development of biodiversity, carbon, and water markets and projects. This dataset was produced by Forest Trends' Ecosystem Marketplace for EnviroAtlas in order to support public access to and use of information related to environmental markets. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains indices of ecological integrity in the upstream catchments and watersheds of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes domestic water demand attributes which provide insight into the amount of water currently used for indoor and outdoor residential purposes in the contiguous United States. The values are based on 2010 water demand and 2010 population distribution, and have been summarized by subwatershed, or 12-digit hydrologic unit code (HUC12). For the purposes of this metric, domestic water use includes residential uses, such as for drinking, bathing, cleaning, landscaping, and pools. Depending on the location, domestic water can be self-supplied, such as by private wells, or publicly-supplied, such as by municipalities. Sources include surface water and groundwater. Estimates are for primary residences only (i.e., excluding second homes and tourism rentals). This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes a number of Discharge Monitoring Report (DMR) metrics summarized by watershed for a given year (https://echo.epa.gov/help/loading-tool/watershed-statistics-help). These metrics include the number of facilities and wastewater discharges located within watersheds according to the Integrated Compliance Information System National Pollutant Discharge Elimination System (ICIS-NPDES), to track the permit compliance and enforcement status of facilities regulated by the NPDES under the Clean Water Act (https://echo.epa.gov/tools/data-downloads/icis-npdes-download-summary). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes a number of Discharge Monitoring Report (DMR) metrics summarized by watershed for a given year (https://echo.epa.gov/help/loading-tool/watershed-statistics-help). These metrics include the number of facilities and wastewater discharges located within watersheds according to the Integrated Compliance Information System National Pollutant Discharge Elimination System (ICIS-NPDES), to track the permit compliance and enforcement status of facilities regulated by the NPDES under the Clean Water Act (https://echo.epa.gov/tools/data-downloads/icis-npdes-download-summary). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes a number of Discharge Monitoring Report (DMR) metrics summarized by watershed for a given year (https://echo.epa.gov/help/loading-tool/watershed-statistics-help). These metrics include the number of facilities and wastewater discharges located within watersheds according to the Integrated Compliance Information System National Pollutant Discharge Elimination System (ICIS-NPDES), to track the permit compliance and enforcement status of facilities regulated by the NPDES under the Clean Water Act (https://echo.epa.gov/tools/data-downloads/icis-npdes-download-summary). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset intelligently reallocates 2010 population from census blocks to 30 meter pixels based on land cover and slope. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset shows the temporal frequency and spatial extent of cyanobacteria cells in large, freshwater lakes and reservoirs across the continental United States derived from 300x300 meter MEdium Resolution Imaging Spectrometer (MERIS) satellite imagery from 2002-2012 and functionally similar Ocean and Land Colour Instrument (OLCI) satellite imagery from 2017-2021. This dataset was produced through a partnership with the National Oceanic and Atmospheric Administration (NOAA), the National Aeronautics and Space Administration (NASA), the United States Geological Survey (USGS), and the United States Environmental Protection Agency (USEPA). This cyanobacteria dataset was derived using the European Space Agency's (ESA) Envisat MERIS sensor and their Sentinel-3 OLCI sensor. MERIS and OLCI are nadir-pointing imaging spectrometers which measure the solar radiation reflected by the Earth in 15 and 21 spectral bands, respectively (visible through near-infrared). MERIS and OLCI imagery was used to identify long-wavelength spectral bands (from red through near-infrared portion of the spectrum) to locate algal blooms within freshwaters and estuaries of the continental United States. EnviroAtlas allows users to spatially explore this cyanobacteria data in the online interactive map viewer. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the continental United States. The dataset is available as downloadable data (https://oceancolor.gsfc.nasa.gov/CYAN/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the acres of land enrolled in the US Department of Agriculture (USDA)'s Conservation Reserve Program (CRP). The CRP is administered by the Farm Service Agency; farmers in the program receive annual payments and establishment cost share to remove environmentally sensitive land from crop production and instead plant perennial species that provide environmental benefits. This dataset was produced by the USDA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national map displays the mean crop phosphorus (P) removal from croplands in the conterminous United States (excluding Hawaii and Alaska) for the year 2012 by 12-digit HUC. These data are based on International Plant Nutrition Institute (IPNI) compilations of county-level major crop harvest and P content of these crops, and cropland area from the USGS's U.S. conterminous wall-to-wall anthropogenic land use trends (NWALT) 2012 land cover data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes data on the area, yield, and number of fruit and vegetable crops grown per 12-digit Hydrologic Unit (HUC) in the conterminous USA. The values are based on data from the United States Department of Agriculture's 2010 Cropland Data Layer (CDL). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset is a point feature class showing the locations of stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents land cover across a watershed and in riparian areas for each 12-digit hydrologic unit code (HUC) in the conterminous United States for use in the Compare my Area tool. These metrics include the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover using the EnviroAtlas hybrid Cropland Data Layer (CDL) - 2011 National Land Cover Dataset (NLCD); the percentage of impervious surface based on the 2011 NLCD Percent Developed Impervious dataset; and the percentage of land area within 45 meters of streams, rivers, and other hydrologically connected waterbodies within each 12-digit HUC that is classified as forest (excluding wetlands), forest including woody wetlands, and natural land cover, based on the 2011 CDL-NLCD. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents land cover across a state and in riparian areas for each state in the conterminous United States for use in the Compare my Area tool. These metrics include the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover using the EnviroAtlas hybrid Cropland Data Layer (CDL) - 2011 National Land Cover Dataset (NLCD); the percentage of impervious surface based on the 2011 NLCD Percent Developed Impervious dataset; and the percentage of land area within 45 meters of streams, rivers, and other hydrologically connected waterbodies within each state that is classified as forest (excluding wetlands), forest including woody wetlands, and natural land cover, based on the 2011 CDL-NLCD. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents land cover across a county and in riparian areas for each county in the conterminous United States for use in the Compare my Area tool. These metrics include the percentage of land area that is classified as natural, forest, wetland, agricultural, natural, and developed land cover using the EnviroAtlas hybrid Cropland Data Layer (CDL) - 2011 National Land Cover Dataset (NLCD); the percentage of impervious surface based on the 2011 NLCD Percent Developed Impervious dataset; and the percentage of land area within 45 meters of streams, rivers, and other hydrologically connected waterbodies within each county that is classified as forest (excluding wetlands), forest including woody wetlands, and natural land cover, based on the 2011 CDL-NLCD. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the commute time of workers to their workplace for each Census Block Group (CBG) during 2008-2012. Data were compiled from the Census ACS (American Community Survey) 5-year Summary Data. The commute time is the amount of travel time in minutes for workers to get from home to work. This value includes private vehicle use, carpooling, public transit, bicycling, or walking. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the percent of workers who commute to work using various modes, and the percent who work from home within each Census Block Group (CBG) during 2008-2012. Data were compiled from the Census ACS (American Community Survey) 5-year Summary Data. The commute modes are the travel methods workers use to get from home to work. The commute modes mapped include private vehicle use (drive alone or carpooling), public transit, bicycling, and walking. Workers who work from home were also reported. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains the results of a cluster analysis of ecological integrity indices for stream confluences. Stream confluences are important components of fluvial networks. Hydraulic forces meeting at stream confluences often produce changes in streambed morphology and sediment distribution, and these changes often increase habitat heterogeneity relative to upstream and downstream locations. Increases in habitat heterogeneity at stream confluences have led some to identify them as biological hotspots. Despite their potential ecological importance, there are relatively few empirical studies documenting ecological patterns across the upstream-confluence-downstream gradient. To facilitate more studies of the ecological value and role of stream confluences in fluvial networks, we have produced a database of stream confluences and their associated watershed attributes for the conterminous United States. The database includes 1,085,629 stream confluences and 383 attributes for each confluence that are organized into 15 database tables for both tributary and mainstem upstream catchments ("local" watersheds) and watersheds. Themes represented by the database tables include hydrology (e.g., stream order), land cover and land cover change, geology (e.g., calcium content of underlying lithosphere), physical condition (e.g., precipitation), measures of ecological integrity, and stressors (e.g., impaired streams). We use measures of ecological integrity (Thornbrugh et al. 2018) from the StreamCat database (Hill et al. 2016) to classify stream confluences using disjoint clustering and validate the cluster results using decision tree analysis. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The EnviroAtlas Climate Scenarios were generated from NASA Earth Exchange (NEX) Downscaled Climate Projections (NEX-DCP30) ensemble averages (the average of over 30 available climate models) for each of the four representative concentration pathways (RCP) for the contiguous U.S. at 30 arc-second (approx. 800 m2) spatial resolution. NEX-DCP30 mean monthly precipitation rate for the 4 RCPs (2.6, 4.5, 6.0, 8.5) were organized by season (Winter, Spring, Summer, and Fall) and annually for the years 2006 – 2099. Additionally, mean monthly precipitation rate for the ensemble average of all historic runs is organized similarly for the years 1950 – 2005. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://cds.nccs.nasa.gov/nex/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The EnviroAtlas Climate Scenarios were generated from NASA Earth Exchange (NEX) Downscaled Climate Projections (NEX-DCP30) ensemble averages (the average of over 30 available climate models) for each of the four representative concentration pathways (RCP) for the contiguous U.S. at 30 arc-second (approx. 800 m2) spatial resolution. In addition to the three climate variables provided by the NEX-DCP30 dataset (minimum monthly temperature, maximum monthly temperature, and precipitation) a corresponding estimate of potential evapotranspiration (PET) was developed to match the spatial and temporal scales of the input dataset. PET represents the cumulative amount of water returned to the atmosphere due to evaporation from Earth’s surface and plant transpiration under ideal circumstances (i.e., a vegetated surface shading the ground and unlimited water supply). PET was calculated using the Hamon PET equation (Hamon, 1961) and CBM model for daylength (Forsythe et al. 1995) for the 4 RCPs (2.6, 4.5, 6.0, 8.5) and organized by season (Winter, Spring, Summer, and Fall) and annually for the years 2006 – 2099. Additionally, PET was calculated for the ensemble average of all historic runs and organized similarly for the years 1950 – 2005. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://cds.nccs.nasa.gov/nex/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The EnviroAtlas Climate Scenarios were generated from NASA Earth Exchange (NEX) Downscaled Climate Projections (NEX-DCP30) ensemble averages (the average of over 30 available climate models) for each of the four representative concentration pathways (RCP) for the contiguous U.S. at 30 arc-second (approx. 800 m2) spatial resolution. NEX-DCP30 mean monthly minimum temperature for the 4 RCPs (2.6, 4.5, 6.0, 8.5) were organized by season (Winter, Spring, Summer, and Fall) and annually for the years 2006 – 2099. Additionally, mean monthly minimum temperature for the ensemble average of all historic runs is organized similarly for the years 1950 – 2005. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://cds.nccs.nasa.gov/nex/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The EnviroAtlas Climate Scenarios were generated from NASA Earth Exchange (NEX) Downscaled Climate Projections (NEX-DCP30) ensemble averages (the average of over 30 available climate models) for each of the four representative concentration pathways (RCP) for the contiguous U.S. at 30 arc-second (approx. 800 m2) spatial resolution. NEX-DCP30 mean monthly maximum temperature for the 4 RCPs (2.6, 4.5, 6.0, 8.5) were organized by season (Winter, Spring, Summer, and Fall) and annually for the years 2006 – 2099. Additionally, mean monthly maximum temperature for the ensemble average of all historic runs is organized similarly for the years 1950 – 2005. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://cds.nccs.nasa.gov/nex/) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The Cleveland, OH EnviroAtlas Meter-scale Urban Land Cover (MULC) dataset comprises 2,737 km2 around the city of Cleveland and portions of surrounding counties. The area classified is based on the US Census Bureau's 2010 Urban Area for Cleveland, OH with a 1 km buffer added. This area includes the majority of Cuyahoga and Lake Counties, and portions of Ashtabula, Geauga, Medina, Lorain, Portage and Summit Counties. These MULC data and maps were derived from LiDAR and 1-m pixel, four-band (red, green, blue, and near-infrared) leaf-on aerial photography acquired from the United States Department of Agriculture (USDA) National Agriculture Imagery Program (NAIP) in 2011 and 2013. The NAIP imagery was collected on several dates: August 12, 2011, September 03, 2011 and August 24, 2013. The data was comprised of 85% 2011 NAIP and 15% 2013 NAIP imagery. LiDAR data collected between March 18, 2006 and May 07, 2006 covered the entire study area. Six land cover classes were mapped: Water, Impervious Surfaces, Soil/Barren, Trees/Forest, Grass/Herbaceous Non-Woody Vegetation, and Wetlands (Woody and Emergent). Wetlands were copied from the best available existing wetlands data, which was a National Wetlands Inventory (NWI) layer from 2006. An analysis of 500 completely random and 81 stratified random photo-interpreted land cover reference points yielded an overall user's accuracy of 86.2% (see confusion matrix below). This dataset was produced by the US EPA, the University of Vermont, and the US Forest Service to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the number and density of candidate areas for ecological restoration in each 12-digit HUC. Ecological restoration may become a more prominent means of environmental conservation in the future, and landscape context and connectivity are important emerging principles in ecological restoration science. We used morphological spatial pattern analysis (MSPA) to identify candidate restoration areas based on their proximity to large vegetated regions. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset shows the candidate areas for ecological restoration, identified as close but geographically disjunct vegetated regions. Ecological restoration may become a more prominent means of environmental conservation in the future, and landscape context and connectivity are important emerging principles in ecological restoration science. We used morphological spatial pattern analysis (MSPA) to identify candidate restoration areas based on their proximity to large vegetated regions. We then populated the candidate sites with 17 attributes related to site content (e.g., soil productivity) and site context (area of surrounding vegetated regions).
    1
    4 days ago
  • This EnviroAtlas dataset consists of the 2010 Puerto Rico and 2012 U.S. Virgin Islands C-CAP (Coastal Change Analysis Program) rasters, modified for use in EnviroAtlas. The original C-CAP rasters were produced by the NOAA (National Oceanic and Atmospheric Administration) Office for Coastal Management. In the EnviroAtlas version, the C-CAP rasters have been mosaicked together. Fields containing equivalent NLCD (National Land Cover Database) classes have been added so that processes used to develop NLCD-based EnviroAtlas datasets can be more easily applied to Puerto Rico and the Virgin Islands; the colormap has also been modified to match the NLCD colormap. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains high-resolution (2.4 meter) land cover data for Hawaii from C-CAP (Coastal Change Analysis Program), modified for use in EnviroAtlas. The original C-CAP rasters were produced by the NOAA (National Oceanic and Atmospheric Administration) Office for Coastal Management. The C-CAP rasters have been mosaicked into a single raster, projected to Albers, and have additional information added about corresponding NLCD (National Land Cover Database) classes. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains data on the mean cultivated biological nitrogen fixation (C-BNF) in cultivated crop and hay/pasture lands per 12-digit Hydrologic Unit (HUC) in 2006. Nitrogen (N) inputs from the cultivation of legumes, which possess a symbiotic relationship with N-fixing bacteria, were calculated with a recently developed model relating county-level yields of various leguminous crops with BNF rates. We accessed county-level data on annual crop yields for soybeans (Glycine max L.), alfalfa (Medicago sativa L.), peanuts (Arachis hypogaea L.), various dry beans (Phaseolus, Cicer, and Lens spp.), and dry peas (Pisum spp.) for 2006 from the USDA Census of Agriculture (http://www.agcensus.usda.gov/index.php). We estimated the yield of the non-alfalfa leguminous component of hay as 32% of the yield of total non-alfalfa hay (http://www.agcensus.usda.gov/index.php). Annual rates of C-BNF by crop type were calculated using a model that relates yield to C-BNF. We assume yield data reflect differences in soil properties, water availability, temperature, and other local and regional factors that can influence root nodulation and rate of N fixation. We distributed county-specific, C-BNF rates to cultivated crop and hay/pasture lands delineated in the 2006 National Land Cover Database (30 x 30 m pixels) within the corresponding county. C-BNF data described here represent an average input to a typical agricultural land type within a county, i.e., they are not specific to individual crop types. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the total number of vacant business addresses for each Census Tract for each year from 2010-2014. Vacant buildings are included if they remained vacant for more than one year. Data were compiled from the United States Postal Service (USPS) Vacant Address Data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset portrays the vacancy rate for business addresses for each Census Tract for each year from 2010-2014. Vacant buildings are included if they remained vacant for more than one year. Data were compiled from the United States Postal Service (USPS) Vacant Address Data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains data on the mean biological nitrogen fixation in natural/semi-natural ecosystems per 12-digit Hydrologic Unit (HUC) in 2006. Biological N fixation (BNF) in natural/semi-natural ecosystems was estimated using a correlation with actual evapotranspiration (AET). This correlation is based on a global meta-analysis of BNF in natural/semi-natural ecosystems (Cleveland et al. 1999). AET estimates for 2006 were calculated using a regression equation describing the correlation of AET with climate (average annual daily temperature, average annual minimum daily temperature, average annual maximum daily temperature, and annual precipitation) and land use/land cover variables in the conterminous US (Sanford and Selnick 2013). Data describing annual average minimum and maximum daily temperatures and total precipitation for 2006 were acquired from the PRISM climate dataset (http://prism.oregonstate.edu). Average annual climate data were then calculated for individual 12-digit USGS Hydrologic Unit Codes (HUC12s; https://water.usgs.gov/GIS/huc.html; 22 March 2011 release) using the Zonal Statistics tool in ArcMap 10.0. AET for individual HUC12s was estimated using equations described in Sanford and Selnick (2013). BNF in natural/semi-natural ecosystems within individual HUC12s was modeled with an equation describing the statistical relationship between BNF (kg N ha-1 yr-1) and actual evapotranspiration (AET; cm yr-1) and scaled to the proportion of non-developed and non-agricultural land in the HUC12. The first half of the equation represents the most conservative estimate in a meta-analysis of BNF in natural/semi-natural ecosystems (Cleveland et al. 1999), and was chosen over the central and high estimates because recent, top-down global mass balances that suggest that natural BNF rates are less than previous estimates based on scaled-up estimates from individual plots (Vitousek et al. 2013). The land use/land cover modifier is not included in the original Cleveland et al. (1999) analysis. We believe it is appropriate to include so as not to overestimate BNF in HUC12s with large proportions of urban or agricultural development. These data represent an average N input to individual HUC12s, i.e., they are not specific to an individual land use type within the HUC12. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This dataset was produced by a joint effort of New Mexico State University (NMSU), the U.S. Environmental Protection Agency (EPA), and the U.S. Geological Survey (USGS) to support research and online mapping activities related to EnviroAtlas. Ecosystem services, i.e., services provided to humans from ecological systems, have become a key issue of this century in resource management, conservation planning, and environmental decision analysis. Mapping and quantifying ecosystem services have become strategic national interests for integrating ecology with economics to help understand the effects of human policies and actions and their subsequent impacts on both ecosystem function and human well-being. Some aspects of biodiversity are valued by humans in varied ways, and thus are important to include in any assessment that seeks to identify and quantify the benefits of ecosystems to humans. Some biodiversity metrics clearly reflect ecosystem services (e.g., abundance and diversity of harvestable species), whereas others may reflect indirect and difficult to quantify relationships to services (e.g., relevance of species diversity to ecosystem resilience, or cultural and aesthetic values). Wildlife habitat has been modeled at broad spatial scales and can be used to map a number of biodiversity metrics. We map 15 biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for bird species. Metrics include all bird species richness, lists identifying species of conservation concern, climate vulnerabilities, etc. This dataset was produced by the Center for Applied Spatial Ecology, New Mexico Cooperative Fish and Wildlife Unit (NMCFWRU), NMSU to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the total number of recreational days per year demanded by people ages 18 and over for bird watching by location in the contiguous United States. These values are based on 2010 population distribution, 2011 U.S. Fish and Wildlife Service (FWS) Fish, Hunting, and Wildlife-Associated Recreation (FHWAR) survey data, and 2011 U.S. Department of Agriculture (USDA) Forest Service National Visitor Use Monitoring program data, and have been summarized by 12-digit hydrologic unit code (HUC). This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the sum of aboveground live dry biomass estimate by 12-digit Hydrologic Unit (HUC) in total metric tons (megagrams) from the 2000 National Biomass and Carbon Dataset (Version 2.0) developed by the Woods Hole Research Center and released in October 2012. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset was produced by a joint effort of New Mexico State University, US EPA, and the US Geological Survey (USGS) to support research and online mapping activities related to EnviroAtlas. Ecosystem services, i.e., services provided to humans from ecological systems, have become a key issue of this century in resource management, conservation planning, and environmental decision analysis. Mapping and quantifying ecosystem services have become strategic national interests for integrating ecology with economics to help understand the effects of human policies and actions and their subsequent impacts on both ecosystem function and human well-being. Some aspects of biodiversity are valued by humans in varied ways, and thus are important to include in any assessment that seeks to identify and quantify the benefits of ecosystems to humans. Some biodiversity metrics clearly reflect ecosystem services (e.g., abundance and diversity of harvestable species), whereas others may reflect indirect and difficult to quantify relationships to services (e.g., relevance of species diversity to ecosystem resilience, or cultural and aesthetic values). Wildlife habitat has been modeled at broad spatial scales and can be used to map a number of biodiversity metrics. We map 15 biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for all vertebrate species except fish. Metrics include species richness for all vertebrates, specific taxon groups, harvestable species (i.e., waterfowl, furbearers, small game, and big game), threatened and endangered species, and state-designated species of greatest conservation need, as well as a metric for ecosystem (i.e., land cover) diversity. The EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset was produced by a joint effort of New Mexico State University, US EPA, and the US Geological Survey (USGS) to support research and online mapping activities related to EnviroAtlas. Ecosystem services, i.e., services provided to humans from ecological systems, have become a key issue of this century in resource management, conservation planning, and environmental decision analysis. Mapping and quantifying ecosystem services have become strategic national interests for integrating ecology with economics to help understand the effects of human policies and actions and their subsequent impacts on both ecosystem function and human well-being. Some aspects of biodiversity are valued by humans in varied ways, and thus are important to include in any assessment that seeks to identify and quantify the benefits of ecosystems to humans. Some biodiversity metrics clearly reflect ecosystem services (e.g., abundance and diversity of harvestable species), whereas others may reflect indirect and difficult to quantify relationships to services (e.g., relevance of species diversity to ecosystem resilience, or cultural and aesthetic values). Wildlife habitat has been modeled at broad spatial scales and can be used to map a number of biodiversity metrics. We map 14 biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for all vertebrate species except fish. Metrics include species richness for all vertebrates, specific taxon groups, harvestable species (i.e., waterfowl, furbearers, small game, and big game), threatened and endangered species, and state-designated species of greatest conservation need, as well as a metric for ecosystem (i.e., land cover) diversity. The EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset contains species richness metrics based on habitat models generated by the U.S. Geological Survey (USGS) National Gap Analysis Project (GAP). Ecosystem services, i.e., services provided to humans from ecological systems have become a key issue of this century in resource management, conservation planning, and environmental decision analysis. Mapping and quantifying ecosystem services have become strategic national interests for integrating ecology with economics to help understand the effects of human policies and actions and their subsequent impacts on both ecosystem function and human well-being. Some aspects of biodiversity are valued by humans in varied ways, and thus are important to include in any assessment that seeks to identify and quantify the benefits of ecosystems to humans. Some biodiversity metrics clearly reflect ecosystem services (e.g., abundance and diversity of harvestable species), whereas others may reflect indirect and difficult to quantify relationships to services (e.g., relevance of species diversity to ecosystem resilience, cultural and aesthetic values). Wildlife habitat has been modeled at broad spatial scales and can be used to map a number of biodiversity metrics. We map 24 biodiversity metrics reflecting ecosystem services or other aspects of biodiversity for terrestrial vertebrate species. Metrics include all species richness, taxa specific species richness and other lists identifying species of conservation concern, climate vulnerabilities, etc. This dataset was produced by a joint effort of New Mexico State University, US EPA, and USGS to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset includes the total number of recreational days per year demanded by people ages 18 and over for big game hunting by location in the contiguous United States. Big game includes deer, elk, bear, and wild turkey. These values are based on 2010 population distribution, 2011 U.S. Fish and Wildlife Service (FWS) Fish, Hunting, and Wildlife-Associated Recreation (FHWAR) survey data, and 2011 U.S. Department of Agriculture (USDA) Forest Service National Visitor Use Monitoring program data, and have been summarized by 12-digit hydrologic unit code (HUC). This dataset was produced by the US EPA to support research and online mapping activities related to the EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset provides the average annual precipitation by 12-digit Hydrologic Unit (HUC). The values were estimated from maps produced by the PRISM Climate Group, Oregon State University. The original data was at the scale of 800 m grid cells representing average precipitation from 1981-2010 in mm. The data was converted to inches of precipitation and then zonal statistics were estimated for a final value of average annual precipitation for each 12 digit HUC. For more information about the original dataset please refer to the PRISM website at http://www.prism.oregonstate.edu/. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas national map displays the mean phosphorus (P) balance between inorganic fertilizer and confined manure inputs and P crop removal on croplands in the conterminous United States (excluding Hawaii and Alaska) for the year 2012 by 12-digit HUC. These data are based on International Plant Nutrition Institute compilations of county-level fertilizer sales data, confined manure production, and major crop harvest and P content of these crops, as well as the cropland area from the USGS's U.S. conterminous wall-to-wall anthropogenic land use trends (NWALT) 2012 land cover data. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset represents the percentage land area that is classified as agricultural land cover that occurs on slopes above a given threshold for each 12-digit hydrologic unit code (HUC) in the conterminous United States. Agricultural land cover is defined using the EnviroAtlas hybrid Cropland Data Layer (CDL) - 2011 National Land Cover Dataset (NLCD). Percentage slope values were derived from the 1 arc-second National Elevation Dataset (NED). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • The national agricultural water demand metric provides insight into the amount of water used for agricultural irrigation in the contiguous United States. The estimates are derived from a water usage rate per 30m cell based on 2010 irrigation water use; an indication of agricultural irrigation based on 2011 crop, 2011 land use, and 2007/2012 remotely sensed irrigation; and summarized by watershed or 12-digit hydrologic unit code (HUC). Agricultural irrigation water use, as defined in this case, meets a variety of needs before, during, and after growing seasons (e.g., dust suppression, field preparation, chemical application, weed control, salt removal from root zones, frost protection, crop cooling, and harvesting). Estimates include self-supplied surface and groundwater, as well as supplies from irrigation-specific organizations (e.g., companies, districts, cooperatives, government). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This EnviroAtlas dataset estimates the average agricultural buffer width, the percentage of agricultural lands with flow paths that would intersect natural land cover before reaching a stream, and the percentage of each subwatershed (12-digit HUC) that is unbuffered agricultural land. Subwatershed summaries are calculated for the contiguous United States. The map uses a combined land use/land cover map from the 2006 National Land Cover Database (NLCD) and the 2010 Cropland Data Layer (CDL). It combines agriculture, forests, grasslands and wetlands with stream networks and elevation datasets in flow path models to find agricultural flow paths that do or do not intersect buffers, and counts the agricultural flow paths through buffers adjacent to streams in order to determine average buffer widths on agricultural lands. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. The dataset is available as downloadable data (https://edg.epa.gov/data/Public/ORD/EnviroAtlas) or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets).
    1
    4 days ago
  • This map service displays data derived from the 2008-2012 American Community Survey (ACS). Values derived from the ACS and used for this map service include: Total Population, Population Density (per square mile), Percent Minority, Percent Below Poverty Level, Percent Age (less than 5, less than 18, and greater than 64), Percent Housing Units Built Before 1950, Percent (population) 25 years and over (with less than a High School Degree and with a High School Degree), Percent Linguistically Isolated Households, Population of American Indians and Alaskan Natives, Population of American Indians and Alaskan Natives Below Poverty Level, and Percent Low Income Population (Less Than 2X Poverty Level). This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States.
    0
    4 days ago
  • The data supporting the findings of this validation report are derived from public domain resources including ground-based networks, atmospheric composition field campaigns, and satellite observations. The specific datasets are categorized as follows: 1. TEMPO Satellite Observations The TEMPO Level 1 (radiances) and Level 2 (trace gas columns) version 3 data products (NO₂, O₃, and HCHO) are available through the NASA Earthdata Search portal under the TEMPO project collection. 2. Validation Reference Data To assess retrieval accuracy, this report utilizes independent measurements from the following sources: Ground-Based Network Observations: • Pandonia Global Network (PGN): High-frequency direct-sun measurements from Pandora spectrometers serve as the primary validation standard. Available at pandonia-global-network.org. • FTIR Network (NDACC): High-resolution solar absorption spectra for trace gas profiles are sourced from the Network for the Detection of Atmospheric Composition Change (NDACC). North American site data are available via the NDACC Data Host Facility. • Brewer and Dobson Spectrometers: Total column ozone (O₃) validation relies on the global network of ultraviolet spectrophotometers. Data are available via the World Ozone and Ultraviolet Radiation Data Centre (WOUDC) at woudc.org. • Intensive Field Campaign Datasets (Summer 2023): This report leverages synergistic observations from the AGES+ multi-agency initiative (AEROMMA, CUPIDS, GOTHAAM, and STAQS), providing high-resolution aircraft and ground measurements: • STAQS: Airborne remote sensing (GCAS) and ground-based lidar (TOLNet) data are archived at the NASA STAQS Data Archive. • AEROMMA: In situ trace gas and aerosol measurements from the NASA DC-8 are available at the NOAA CSL AEROMMA Data Archive. • CUPIDS: Boundary layer dynamics and transport data from the NOAA Twin Otter and ground sites are hosted at the NOAA CSL CUPIDS Archive. • Satellite & Model Datasets: • TROPOMI: Accessed through the Copernicus Data Space Ecosystem. • OMI: Accessed through the NASA Earthdata Search portal. • WRF-Chem Model: University of Wisconsin-Madison 4km retrospective chemistry and aerosol predictions are available via the NOAA CSL AEROMMA Data Archive. Portions of this dataset are inaccessible because: --. They can be accessed through the following means: --. Format: --
    8
    4 days ago
  • The datasets include: First tab: LC methods Second Tab: Weekly glucose measurements in treated LCs. This dataset is associated with the following publication: Vesper, S., H.N. Hoehn, M.C. Grunden, and S.J. Jacquemin. HABS-BLOCKS© Reduced Harmful Algal Bloom Activity in an in-Lake Limno-Corral Mesocosm Case Study at Grand Lake St. Marys, Ohio (USA). BULLETIN OF ENVIRONMENTAL CONTAMINATION AND TOXICOLOGY. Springer, New York, NY, USA, 116(4): 73, (2026).
    1
    4 days ago
  • A comprehensive literature review was conducted with Web of Science to identify relevant studies published between 2013 and October 2024. The search included the keywords ‘Sentinel-2’ or ‘Sentinel 2’ with ‘chl-a’ or ‘chlorophyll-a,’ ‘lakes,’ and ‘water.’ Of the initial 221 studies retrieved, studies were excluded if they (1) only mentioned Sentinel-2 or chlorophyll-a without using them in the analysis, (2) focused on non-water measures such as vegetation or land cover, (3) used synthetic satellite data, (4) used only satellite data (that is, do not include in situ measurements), or (5) included satellites in addition to Sentinel-2 in their analyses and did not separate the results by sensor. This left 122 studies to be reviewed that included both Sentinel-2 satellite data and in situ data. The full collection of studies investigated is referenced. This dataset is associated with the following publication: Goodrich, S., B. Schaeffer, K. Meyers, W. Salls, T. King, B. Seegers, O. Cronin-Golomb, D. Demaree, and M. Reif. Sentinel-2 for chlorophyll-a water quality monitoring: a review of validation evidence and application potential. INTERNATIONAL JOURNAL OF REMOTE SENSING. Taylor & Francis, Inc., Philadelphia, PA, USA, 47(9): 3820-3845, (2026).
    1
    4 days ago
  • Data set for paper from, "Episodic ozone exposure over two weeks alters pulmonary inflammation and gene expression in Long-Evans rats.". This dataset is associated with the following publication: Dye, J., M. Moore, H. Nguyen, M. Schladweiler, V. Adams, J. Richards, W. Williams, R. Grindstaff, U. Kodavanti, and C. Miller. Episodic ozone exposure over two weeks alters pulmonary inflammation and gene expression in Long-Evans rats.. INHALATION TOXICOLOGY. Informa Healthcare USA, New York, NY, USA, 37(7-8): 343-356, (2025).
    1
    4 days ago
  • It contains the raw values for endpoints for individual animals within treatment groups that are reported in tables and figures. This dataset is associated with the following publication: Lewis, A., A. Biales, C. Miller, W. Oshiro, T. Beasley, M. Schladweiler, G. Momplaisir, B. Flick, M.J. See, R. Huang, W. Williams, M. Moore, G. Casuccio, L. Li, M. Deible, R. Grindstaff, T. Jackson, M. Hazari, K. Rogers, K. Ho, and A. Farraj. A Single Oral Exposure to Polyethylene Terephthalate Microplastics Causes Mild Metabolic and Gastrointestinal Disruption: Dose and Sex as Effect Modifiers. DRUG AND CHEMICAL TOXICOLOGY. Marcel Dekker Incorporated, New York, NY, USA, 1-18, (2026).
    1
    4 days ago
  • Dataset contains links to publicly available data: the CMAQ github repository, 2019 FIREX-AQ simulation output from previous work, CMAQ official versions from zenodo, and the CMAQ 2019 inputs used in previous work. This data supports the following work: Farzad, K., Zhang, Y., Tong, D., Ma, S., Tang, Y., Huang, J., et al. (2026). Application and evaluation of a NOAA GFS-driven air quality model using CMAQv5.4 and high-resolution emissions: FIREX-AQ 2019. Journal of Geophysical Research: Atmospheres, 131, e2025JD045668. https://doi.org/10.1029/2025JD045668. This dataset is associated with the following publication: Farzad, K., Y. Zhang, D. Tong, S. Ma, Y. Tang, J. Huang, P. Campbell, H. Pye, B. Murphy, F. Yang, B. Baker, D. Kang, B. Hutzell, and G. Sarwar. Application and Evaluation of a NOAA GFS-Driven Air Quality Model Using CMAQv5.4 and High-Resolution Emissions: FIREX-AQ 2019. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 131(9): e2025JD045668, (2026).
    4
    4 days ago
  • The dataset provided here documents the information used to generate figures for "The Role of Perfluorinated Acyl Fluoride Hydrolysis in Regional-Scale Model Predictions of Per- and Polyfluoralkyl Substance (PFAS) Chemistry, Transport, and Fate" published in ACS Environmental Science & Technology. This dataset is associated with the following publication: D'Ambro, E., B. Murphy, I. Piletic, J. Bash, and H. Pye. The Role of Perfluorinated Acyl Fluoride Hydrolysis in Regional-Scale Model Predictions of Per- and Polyfluoralkyl Substance (PFAS) Chemistry, Transport, and Fate. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 60(17): 13041–13050, (2026).
    3
    4 days ago
  • The worksheet contains microbial, disinfection byproduct (DBP), and other water quality parameters at public water systems distribution network.
    1
    4 days ago
  • Ovalbumin as a carrier protein for per-and polyfluoroalkyl substances (PFAS) in the aquatic environment: Experimental and computational analysis. This dataset is not publicly accessible because: Projects and data are not funded by the EPA and are owned by the collaborating partners involved. It can be accessed through the following means: To obtain the raw data, please contact wenjie.xia@ndsu.edu. Format: The raw data plotted as graphs is included in the journal manuscript. This dataset is associated with the following publication: Arshad , A., S. Mazumdar , M. Quadir , M. Nadagouda, A. Bezbaruah, and W. Xia. Ovalbumin as a PFAS carrier protein in aquatic environments. Cell Reports. Cell Press, Cambridge, MA, USA, 7(2): 103089, (2026).
    0
    4 days ago
  • These data were used to model cyanobacteria abundance and microcystin concentration in lakes across the conterminous US. The data used in this article are publicly available at: https://doi.org/10.23719/1532353
    1
    4 days ago
  • Public data available at https://oceancolor.gsfc.nasa.gov/about/projects/cyan/. Portions of this dataset are inaccessible because: Public data available at https://oceancolor.gsfc.nasa.gov/about/projects/cyan/. They can be accessed through the following means: Public data available at https://oceancolor.gsfc.nasa.gov/about/projects/cyan/. Format: Public data available at https://oceancolor.gsfc.nasa.gov/about/projects/cyan/. This dataset is associated with the following publication: Lavery, A.M., J. Murray, A.F. Pennington, B. Schaeffer, B. Seegers, E. Hilborn, K. Loftin, S. Scroggins, and L. Backer. Cyanobacterial bloom occurrence and emergency department visits for asthma or wheeze, Wisconsin, 2017-2019. Environmental Epidemiology. Wolters Kluwer, Alphen aan den Rijn, NETHERLANDS, 10(3): e439, (2026).
    1
    4 days ago
  • Dataset used to generate figures/results for the Evaluation of Conventional and Electrostatic Sprayers for Decontamination of PPE-covered Manikins in a Personnel Biological Agent Decontamination Line publication. This dataset is associated with the following publication: Archer, J., A. Touati, R.L. Mickelsen, L. Oudejans, M.W. Calfee, S.D. Lee, and A. Abdel-Hady. Evaluation of Conventional and Electrostatic Sprayers for Decontamination of PPE-Covered Manikins. Health Security. SAGE Publications, THOUSAND OAKS, CA, USA, 24(1): 55-65, (2026).
    1
    4 days ago
  • The metadata provided in this entry highlights controlled exposure of healthy young adults to 0.07 ppm ozone for 6.6 hours which causes pulmonary function decline (decreased FEV1/FVC) and increased airway inflammation (%PMN neutrophils) compared to clean air. This study also indicates these effects are accompanied by increased respiratory symptoms, highlighting the effects of prolonged exposure at current air quality standards. This dataset is associated with the following publication: Pennington, E., J. Pulczinski, M. Case, J. Griffin, N. Alexis , C. Robinette, A. Chelminski, A. Davis, N. Miller, A. Ghio, D. Diazsanchez, and A. Rappold. Lung Function and Inflammation in Healthy Young Adults After 6.6 Hours of 0.07 ppm Ozone Exposure. AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE. American Thoracic Society, New York, NY, USA, 124387, (2026).
    1
    4 days ago
  • Numerical data corresponding to figures. This dataset is associated with the following publication: Hensley, J., J. Das Schober, M. Magnuson, and W. Harper. Powdered Activated Carbon Treatment of PFAS-Containing Washwater From Aircraft Hangar Pipe Rinsing. Remediation Journal. John Wiley & Sons, Inc., Hoboken, NJ, USA, 36(2): e70065, (2026).
    1
    4 days ago
  • Numerical data corresponding to figures in manuscript. This dataset is associated with the following publication: Magnuson, M., T. Sleight, and W. Harper. Remediating and reducing the environmental impact of fire suppression systems contaminated with per- and polyfluoroalkyl substances: Perspectives on current guidelines. Fire Safety Journal. Elsevier B.V., Amsterdam, NETHERLANDS, 163: 104811, (2026).
    1
    4 days ago
  • The dataset used for the analysis in the publication, Characterizing Adaptive Capacity for the Future Heat-Related Cardiovascular Morbidity Burden in U.S. Metropolitan Areas (DOI: https://doi.org/10.1016/j.envint.2025.110022). Abstract Exposure to excess heat is linked to increased risks of cardiovascular diseases (CVD). As temperatures increase globally, it is crucial to examine the potential increase in excess heat-related CVD (xHEAT-CVD) burden to inform strategies for adaptation. This study aimed to identify the contextual factors associated with future xHEAT-CVD burden among older adults across eighty U.S. metropolitan statistical areas (MSAs). The MSA-specific xHEAT-CVD risk for adults ≥ 65 years was estimated using hospitalization and temperature data from 2000 to 2017, with excess heat defined as temperatures above the minimum hospitalization percentile (TMHP). Future xHEAT-CVD hospitalizations were estimated using temperature projections for 2025–2054, 2045–2074, and 2070–2099 under three climate scenarios. Area-level variables were used to identify demographic and economic status, health, environment, and infrastructure contexts and derive Urban Heat Health Risk (UHHR) scores using confirmatory factor analysis. The associations between adaptive capacity (the UHHR scores) and future xHEAT-CVD burden were examined. In 2070–2099 under the mildest scenario, 36 more days annually were projected to be ≥ TMHP, and xHEAT-CVD burden was projected to increase by at least 20.4-fold. Lower adaptive capacity was associated with greater increases in future xHEAT-CVD burden, over 9-fold increase per 1-unit increase in UHHR score (9.1, 95 % Confidence Intervals: 2.8–15.4). The historical xHEAT-CVD burden (2000–2017) was largely driven by the health context, whereas environment played a more important role in the future. Our findings suggest that drivers of the xHEAT-CVD burden may vary across time. Targeting the areas with the highest xHEAT-CVD burden at varying timeframes can help mitigate xHEAT-CVD burden more effectively. This dataset is associated with the following publication: Tsai, W., M. Mcinroe, A. Jalowska, C. Keeler, S. Cleland, C. O'Lenick, T. Spero, A. Schneider, and A. Rappold. Characterizing Adaptive Capacity for the Future Heat-Related Cardiovascular Morbidity Burden in U.S. Metropolitan Areas. ENVIRONMENT INTERNATIONAL. Elsevier B.V., Amsterdam, NETHERLANDS, 207: 110022, (2026).
    1
    4 days ago
  • Spreadsheet summarizing data used to prepare figures in main body of manuscript. Note that an additional spreadsheet (the "SI Summary Spreadsheet") will be published alongside the manuscript and made available for free which includes tabs detailing the following content: Compound Metadata, Canister Sample Concentrations, and Wind Direction Bin-wide Median Concentrations. Since this spreadsheet will be free/open-access (since SI material), it is not included here. Please review the manuscript on the ACS ES&T Air website to access it. This dataset is associated with the following publication: Champion, W., M. MacDonald, B. Thomas, J. Carpenter, I. George, and E. Thoma. Assessing Above-Ground Fuel Storage Tank Emissions Using Lower-Cost Sensor Packages and Triggered Canister Samples. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 3(4): 934-942, (2026).
    1
    4 days ago
  • Supporting information for "Combined In Vitro and In Silico Workflow to Deliver Robust, Transparent, and Contextually Rigorous Models of Bioactivity". This dataset is associated with the following publication: Charest, N., G. Sinclair, S. Eytcheson, D. Chang, T. Martin, C. Lowe, K. Friedman, and A. Williams. Combined In Vitro and In Silico Workflow to Deliver Robust, Transparent, and Contextually Rigorous Models of Bioactivity. Journal of Chemical Information and Modeling. American Chemical Society, Washington, DC, USA, 65(9): 4426-4441, (2025).
    4
    4 days ago
  • This research focused on developing and evaluating nitrogen-stable isotope condition assessment bioindicators and monitoring methods for low gradient coastal stream systems to assist states in assessing the condition of low-gradient coastal systems. Low-gradient coastal stream systems support important landscape level ecological functions by connecting uplands and marshes directly to large tidal rivers, estuaries, and coastal waterbodies. In this study we develop and evaluate innovative monitoring and assessment methods to support biological indicator development for waterbody types and taxa that lack nationally consistent and reliable approaches. Low-gradient tidal and non-tidal coastal stream systems are infrequently included in national and regional monitoring programs and may require different methods than freshwater streams (US EPA National River and Streams Assessment) or large tidal rivers (US EPA National Coastal Condition Assessment). Results from this study demonstrate that stable isotopes of nitrogen (δ15N) bioindicators from a variety of biotic trophic levels can be used as an efficient and effective rapid monitoring tool for assessing biotic condition in low gradient coastal systems. These stable isotope indicators also provide empirical field measurements for ground-truthing national indices which are derived from remotely sensed national landscape data layers. The δ15N biotic responses were consistently significant across all trophic levels and negatively correlated with landscape level stressor exposure conditions reflected in the national and regional scale indices. Verifying national multiscale indices with site-scale field measured bioindicators (δ15N) provides coastal managers, states, tribal, regional, and local watershed organizations confidence in using these national indices at local watershed and catchment scales for identifying and prioritizing protection for healthy coastal stream networks and watersheds, as well as targeting critical functional elements of watersheds for restoration efforts. This dataset is associated with the following publication: Kuhn, A., M. Schwartz, J. Serbst, J. Lake, L. Coiro, and M. Charpentier. Ground truthing national multiscale landscape indices with nitrogen-stable isotopes for low-gradient coastal stream ecosystems. ENVIRONMENTAL MONITORING AND ASSESSMENT. Springer, New York, NY, USA, 198: 339, (2026).
    2
    4 days ago
  • Data is for manuscript entitled "PFAS Quantitation with Diffusive Gradients in Thin-Film Passive Samplers: Capturing Time-Weighted Average Concentrations Around Current Maximum Contaminant Levels". This dataset is not publicly accessible because: The data was not generated by EPA. It can be accessed by contacting the corresponding author. It can be accessed through the following means: Contact the manuscript corresponding author: Julian L. Fairey at julianf@uark.edu. Format: N/A. This dataset is associated with the following publication: Harris, B., S. Hodges, D. Wahman, L. Haupert, J. Chimka, and J. Fairey. PFAS Quantitation with Diffusive Gradients in Thin-Film Passive Samplers: Capturing Time-Weighted Average Concentrations Around Current Maximum Contaminant Levels to Facilitate Compliance. Environmental Science: Advances. Royal Society of Chemistry, London, UK, 300: 125918, (2026).
    0
    4 days ago
  • Supplementary data for "Transcriptomic response of an algal species (Raphidocelis subcapitata) exposed to 22 per- and polyfluoroalkyl substances". Portions of this dataset are inaccessible because: N/A. They can be accessed through the following means: N/A. Format: Raw FASTQ files, raw count matrix files, and normalized expression count matrices have been submitted to the Gene Expression Omnibus (Accession GSE269539). This dataset is associated with the following publication: Flynn, K., K. Bush, J. Cavallin, M. Hazemi, A. Kasparek, P. Schumann, and D. Villeneuve. Transcriptomic response of an algal species (Raphidocelis subcapitata) exposed to 22 per- and polyfluoroalkyl substances. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(4): 995-1006, (2025).
    1
    4 days ago
  • This dataset can be used to produce soil infiltration estimates for the general vicinity of a small hydrologic catchment in the vicinity of Fittstown, Oklahoma.
    4
    4 days ago
  • This dataset contains data generated from a study evaluating the effects of 1H,1H,10H,10H-perfluorodecane-1,10-diol (FC10-diol), in a multi-endpoint reproduction assay with the fathead minnow designed specifically for endocrine-disrupting chemicals. Fish were exposed for 21 d to five water concentrations of FC10-diol ranging from 0.68 to 68 µg/L, as well as 17β-estradiol (15 ng/L) as a positive control. The FC10-diol produced a suite of responses in both males and female fish that were indicative of a classical estrogen-receptor (ER) agonist, including significant effects on reproduction. Responses in males included changes in expression of four hepatic genes controlled by ER, induction of plasma vitellogenin (VTG), decreased expression of male secondary sexual characteristics, histopathological changes in the testis and kidney, and mortality in the highest FC10-diol treatment group. Effects in females from the high treatment group included altered ovarian expression of genes involved in steroid synthesis, decreased plasma steroids, elevated plasma VTG, and histological changes in the ovary and kidney. This dataset is associated with the following publication: Ankley, G., K. Jensen, J. Cavallin, C. Baettig, S. Balgooyen, B. Blackwell, C. Blanksma, J. Collins, M. Ellman, J. Hoang, M. Kahl, K. Santana-Rodriguez, C. Schaupp, E. Stacy, and D. Villeneuve. Effects of a novel estrogenic perfluoroalkyl substance on reproductive endocrinology and function in the fathead minnow (Pimephales promelas). ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(3): 786-801, (2025).
    1
    4 days ago
  • This Dataset includes the spatial and temporal measurements of water quality probe parameters taken in the field within the canal and river system of St. Mary's, OH for the years 2023-2025.
    1
    4 days ago
  • Spatially explicit nutrient budgets are critical for managing nutrients and improving water quality. Yet, these budgets are resource-intensive to develop at the scales and extents needed for achieving management goals. In this paper we introduce StreamCatNNI and LakeCatNNI, an integration of the United States Environmental Protection Agency's (USEPA) Next Generation National Nutrient Inventory (NNI) with the StreamCat database. The NNI provides 30-year annual time-series (1987-2017) of nitrogen (N) and phosphorus (P) budgets for US counties. The NNI's integration with StreamCat yields watershed and local catchment N and P budgets for ~2.64 million stream segments and 378,088 lakes. These budgets contain major anthropogenic and natural inputs, outputs, agricultural surplus, and legacy agricultural surplus for N and P. StreamCatNNI and LakeCatNNI data were calculated using 1) a tabular dasymetric apportionment process to downscale NNI nutrient data to local drainages, then 2) the StreamCat accumulation framework to derive watershed nutrient budgets. StreamCatNNI and LakeCatNNI data underwent a variety of spatial quality assurance evaluations, and workflow components are publicly available for replication. This repository contains LakeCatNNI data. A second repository is maintained for StreamCatNNI.
    16
    4 days ago
  • Background: Accelerated transcriptomic and/or epigenetic age have been proposed as biomarkers of disrupted systemic health and of increased sensitivity to environmental exposures. Previously, we observed epigenetic age acceleration as a biomarker of sensitivity to air pollution, especially for traffic-related air pollution (TRAP) in urban cohorts. Methods: Using 1024 participants from the CATHGEN cohort, we evaluated whether increased cardiovascular risk associated with TRAP was modified by transcriptomic aging. Residential proximity to major roadways was the measure of TRAP and peripheral arterial disease (PAD) and blood pressure were outcomes. Blood-based gene expression-based age acceleration (GEXAge AAD) and Horvath epigenetic age acceleration (DNAmAge AAD) were measures of age acceleration, and models were adjusted for chronological age, race, sex, smoking, socioeconomic status, body mass index, hyperlipidemia, and diabetes. Results: We observed significant interactions between TRAP and GEXAge AAD and DNAmAge AAD, but these interactions were weaker than in previous analyses including only urban communities. Constraining the cohort to those residing in more urban environments strengthened the interaction between GEXAge AAD and TRAP. Interactions indicated that increased transcriptomic or epigenetic age elevated associations between proximity to roadways and PAD; the strongest interactions were identified in individuals with both accelerated epigenetic and transcriptomic age. Exploratory sex-stratified analyses identified potentially stronger associations in males, but these results would require further validation in larger studies. Conclusion: Similar to epigenetic age, elevated transcriptomic age may be an indicator of increased TRAP sensitivity. Individuals with jointly elevated epigenetic and transcriptomic age may have greater environmental health risks than those with elevated transcriptomic age alone. This dataset is not publicly accessible because: It is Duke University data. It can be accessed through the following means: Contact Lydia Kwee at Duke University. Format: Data is available at Duke University. This dataset is associated with the following publication: Jackson, T., L. Kwee, S. Shah, E. Hauser, W. Kraus, and C. Ward-Caviness. Accelerated transcriptomic age and susceptibility to traffic-related air pollution among cardiac catheterization patients. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 999: 180293, (2025).
    0
    4 days ago
  • Dataset for "Schaupp CM, Byrne G, Chan M, Haggard DE, Hazemi M, Jankowski MD, LaLone CA, LaTier A, Mattingly KZ, Olker JH, Renner J, Sharma B, Villeneuve DL. An automated computational data pipeline to rapidly acquire, score, and rank toxicological data for ecological hazard assessment. Integr Environ Assess Manag. 2024 May 16. doi: 10.1002/ieam.4945. Epub ahead of print. PMID: 38752675.". This dataset is associated with the following publication: Schaupp, C., G. Byrne, M. Chan, D. Haggard, M. Hazemi, M. Jankowski, C. LaLone, A. LaTier, K. Mattingly, J. Olker, J. Renner, B. Sharma, and D. Villeneuve. An automated computational data pipeline to rapidly acquire, score, and rank toxicological data for ecological hazard assessment. Integrated Environmental Assessment and Management. Allen Press, Inc., Lawrence, KS, USA, 20(6): 2203-2217, (2024).
    3
    4 days ago
  • Air quality sensor and filter data from Puente Jobos, Puerto Rico during 2023 and 2024. Data set includes data used to generate figures in the manuscript, hourly sensor data, and daily sensor and filter data. This dataset is associated with the following publication: Holder, A., S. Pender, G. Lau, M. Landis, M. Colón, F. Nojavan Asghari, K. Kovalcik, G. Norris, and G. Hagler. Estimating Variation and Sources of Dust in Puente Jobos, Puerto Rico, Using a PM10 Sensor Network. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 3(4): 990–1003, (2026).
    3
    4 days ago
  • Supplemental material for "Stable isotopes reveal an imprint of harmful algal blooms on Lake Erie". This dataset is associated with the following publication: Benesh, K., A. Banerji, S. Ludsin, T. Jicha, P. Collingsworth, A. Fosso, W. Currie, J. Hood, M. Manubolu, L. Rudstam, J. Watkins, and J. Hoffman. Stable isotopes reveal an imprint of harmful algal blooms on Lake Erie. Aquatic Ecosystem Health and Management. Taylor & Francis, Inc., Philadelphia, PA, USA, 28(1): 51-66, (2025).
    1
    4 days ago
  • All data presented in the associated manuscript, see readme tab for description and Data Dictionary. This dataset is associated with the following publication: Laiveling, A., C. Wiesner-Friedman, and M. Jahne. Evaluating pathogen modeling approaches for microbial risk assessment of stormwater in recreational and reuse contexts. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 181630, (2026).
    1
    4 days ago
  • Supporting Information for "In Vitro Screening for ToxCast Chemicals Binding to Thyroxine-Binding Globulin". This dataset is associated with the following publication: Eytcheson, S., A. Zosel, J. Olker, M. Hornung, and S. Degitz. In Vitro Screening for ToxCast Chemicals Binding to Thyroxine-Binding Globulin. CHEMICAL RESEARCH IN TOXICOLOGY. American Chemical Society, Washington, DC, USA, 37(10): 1660-1669, (2024).
    2
    4 days ago
  • Peer-reviewed publication titled "An Environmental Heath Vocabulary and its Semi-Automated Curation Workflow". This dataset is associated with the following publication: Angrish, M., S. Burns, J. Cleland, C. Foster, S. Kovach, K. Markey, B. Schultz, A. Shapiro, M. Taylor, G. Woodall, and S. Watford. An Environmental Health Vocabulary and its Semi-Automated Curation Workflow. Evidence-Based Toxicology. Taylor & Francis Group, London, UK, 3(1): 2485111, (2025).
    2
    4 days ago
  • This dataset contains projected area loss of current mangrove areas in the United States and its territories due to sea level rise (SLR). It also contains projections of carbon loss and ecosystem service valuation loss for each given area loss. This dataset is associated with the following publication: Shank, K.I., R.B. Rice, C.P. Weaver, and S.D. LeDuc. Mangrove Areas in the United States Likely to Be Submerged by Projected Sea Level Rise: Declines in Areal Extent, Carbon Sequestration, And Ecosystem Services. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 6(3): 1592-1600, (2026).
    1
    4 days ago
  • This dataset is associated with an article submitted for publication in a peer reviewed journal titled "Water column toxicity of several DDT congeners to Hyalella azteca, and its implications for contaminated sediment assessment". To inform ecological risk assessment for freshwater sediments, we tested the toxicity of water column exposure to six DDT congeners, specifically the p,p’ (4,4’) forms of DDT, dichlorodiphenyldichloroethylene (DDE), dichlorodiphenyldichloroethane (DDD), and dichlorodiphenylchloroethylene (DDMU), as well as the o,p’ (2,4’) forms of DDT and DDD. The test organism was the amphipod Hyalella azteca, exposed for 7 days and assessed for changes in survival and growth. It includes chemical and biological data collected during those tests as well as the results of regression analyses used to calculate of median and 20% effect concentrations for survival and biomass gain. This dataset is associated with the following publication: Mount, D., L. Burkhard, J.R. Hockett, C. Holloway, S. Howe, J. Jenson, S. Kadlec, A. Kasparek, T. Lahren, K. Lott, E. Piasecki, J. Swanson, and L. Votava. Waterborne toxicity of several dichlorodiphenyltrichloroethane congeners to Hyalella azteca and its implications for contaminated sediment assessment. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(3): 728-736, (2025).
    1
    4 days ago
  • Co-authored the review of extreme rainfall methodologies used by USFS. Publiished by USFS. This dataset is associated with the following publication: Mukherjee, S., D. Amatya, A. Jalowska, J. Campbell, S. Johnson, K. Elder, S. Panda, J. Grace, and D. Kikoyo. Comparison of on-site versus NOAA’s extreme precipitation intensity-duration-frequency estimates for six forest headwater catchments across the continental United States. Stochastic Environmental Research and Risk Assessment. Springer-Verlag, BERLIN-HEIDELBERG, GERMANY, 37: 4051-4070, (2023).
    1
    4 days ago
  • This repository contains data used to model stream and lake temperatures and benthic macro invertebrate (BMI) assemblages in conterminous US streams and lakes. The code used to generate these data and to model stream/lake temperatures and BMI taxa are available on GitHub: https://github.com/USEPA/bmi_stream_lake_model.
    2
    4 days ago
  • Spatially explicit nutrient budgets are critical for managing nutrients and improving water quality. Yet, these budgets are resource-intensive to develop at the scales and extents needed for achieving management goals. In this paper we introduce StreamCatNNI and LakeCatNNI, an integration of the United States Environmental Protection Agency's (USEPA) Next Generation National Nutrient Inventory (NNI) with the StreamCat database. The NNI provides 30-year annual time-series (1987-2017) of nitrogen (N) and phosphorus (P) budgets for US counties. The NNI's integration with StreamCat yields watershed and local catchment N and P budgets for ~2.64 million stream segments and 378,088 lakes. These budgets contain major anthropogenic and natural inputs, outputs, agricultural surplus, and legacy agricultural surplus for N and P. StreamCatNNI and LakeCatNNI data were calculated using 1) a tabular dasymetric apportionment process to downscale NNI nutrient data to local drainages, then 2) the StreamCat accumulation framework to derive watershed nutrient budgets. StreamCatNNI and LakeCatNNI data underwent a variety of spatial quality assurance evaluations, and workflow components are publicly available for replication. This repository contains StreamCatNNI data. A second repository is maintained for LakeCatNNI.
    20
    4 days ago
  • Supporting information for "Screening the ToxCast Chemical Libraries for Binding to Transthyretin". This dataset is associated with the following publication: Eytcheson, S., A. Zosel, J. Olker, M. Hornung, and S. Degitz. Screening the ToxCast Chemical Libraries for Binding to Transthyretin. CHEMICAL RESEARCH IN TOXICOLOGY. American Chemical Society, Washington, DC, USA, 37(10): 1670-1681, (2024).
    2
    4 days ago
  • The data saved here are for a forthcoming article, Projecting and valuing climate change impacts on anxiety and depression in the contiguous United States. This dataset is associated with the following publication: Belova, A., K. Munson, D. Keeler, M. Sluder, A. Kiesel, M.C. Sarofim, R. Silva, S. Anenberg, S. Clayton, and C.A. Gould. Projecting and valuing climate change impacts on anxiety and depression in the contiguous USA: a damage function approach. The Lancet Planetary Health. Elsevier B.V., Amsterdam, NETHERLANDS, 10(2): 101426, (2026).
    37
    4 days ago
  • Supplementary information for "Examining environmental matrix effects on quantitative non-targeted analysis estimates of per- and polyfluoroalkyl substances". This dataset is associated with the following publication: Pu, S., J. McCord, R. Dickman, N. Sayre-Smith, H. Sepman, A. Kruve, D. Aga, and J. Sobus. Examining environmental matrix effects on quantitative non-targeted analysis estimates of per- and polyfluoroalkyl substances. Analytical and Bioanalytical Chemistry. Springer, New York, NY, USA, 417(10): 2097-2110, (2025).
    5
    4 days ago
  • Supplementary material and data links for "Retrospective stepwise prioritization of chemicals detected in Great Lakes tributaries (2008–2018)". This dataset is associated with the following publication: Maloney, E., S. Corsi, M. Pronschinske, L. DeCicco, J. Frisch, N. Fuller, A. Baldwin, K. Kimbrough, M. Edwards, S. Hummel, N. Garcia Reyero, and D. Villeneuve. Retrospective stepwise prioritization of chemicals detected in Great Lakes tributaries (2008–2018). ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(7): 2048-2069, (2025).
    4
    4 days ago
  • Raw data associated with the manuscript titled Application of Transcriptomics Concentration-Response Modeling for Prioritization of Contaminants Detected in Tributaries of the North American Great Lakes (Cavallin et al., 2025). This dataset is associated with the following publication: Cavallin, J., K. Bush, S. Corsi, L. DeCicco, K. Flynn, A. Kasparek, M. Hazemi, E. Maloney, P. Schumann, and D. Villeneuve. Application of transcriptomics concentration-response modeling for prioritization of contaminants detected in tributaries of the North American Great Lakes. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(5): 1310-1321, (2025).
    2
    4 days ago
  • Experimental results from in vitro analysis for Confirmation of Estrogenic and Antiandrogenic Pesticide Bioactivity using Schild Regression Analysis. This dataset is associated with the following publication: Boxberger, C., L. Gray, N. Evans, J. Conley, and E. Medlock Kakaley. In Vitro Confirmation of Estrogenic and Antiandrogenic Pesticide Bioactivity using Schild Regression Analysis. TOXICOLOGY AND APPLIED PHARMACOLOGY. Elsevier B.V., Amsterdam, NETHERLANDS, 504: 117523, (2025).
    1
    4 days ago
  • Temporal_mismatch. This dataset is not publicly accessible because: Property of the University of NC Institute for Marine Sciences. It can be accessed through the following means: Data are available for multiple purposes through HydroShare http://www.hydroshare.org/resource/671fefb82cc94504a6734717d8aae48d. Format: YSI sonde data owned and operated by UNC IMS. This dataset is associated with the following publication: Cronin-Golomb, O., K. Meyers, W. Salls, and B. Schaeffer. Quantifying temporal mismatches in satellite and in-situ data for aquatic environments.. Remote Sensing Letters. Taylor & Francis Group, London, UK, 17(4): 404-415, (2026).
    0
    4 days ago
  • Abstract copied from manuscript July 21, 2025 Launched in April 2023, the Tropospheric Emissions: Monitoring of Pollution (TEMPO), instrument provides for the first time hourly measurements of atmospheric pollutants over most of North America at high spatial resolution (˜ 2 × 4.75 km2). This evaluation of TEMPO’s first year demonstrates the capability of total formaldehyde column retrievals (ΩHCHO, version 3) at different locations, seasons, and meteorological conditions. The ΩHCHO product is assessed using 36 ground-based Pandora direct-sun measurements from Pandonia Global Network (PGN) as a reference dataset. The 36 PGN sites were chosen for consistency in direct-sun and sky-scan measurement modes. In the first year of operation, TEMPO ΩHCHO exhibit moderate to strong agreement at PGN sites in both measurement modes (R2 = 0.63 to 0.85). TEMPO shows a small bias of -2 ± 20% at lower ΩHCHO (< 1.0×1016 molecule cm-2) and a larger underestimation of -22 ± 5% at higher ΩHCHO (> 1.5×1016 molecule cm-2). TEMPO clearly captures the seasonal variability of ΩHCHO, with summer values exceeding those in winter, spring, and fall by 62%, 45%, and 29%, respectively. TEMPO shows no consistent bias at any time of day with excellent agreement for different meteorological conditions. For all hourly differences between TEMPO and Pandora, 96% fall within 1 × 1016 molecules cm-2. TEMPO provides almost 50% more days with at least one observation compared to observations only at 1 pm. These findings confirm the high quality of TEMPO’s ΩHCHO measurements under a wide variety of conditions and show great promise for future scientific applications. Portions of this dataset are inaccessible because: All publicly available. They can be accessed through the following means: Via links provided. Format: Data Availability Statement. All data are publicly available. The Pandora data is available at PGN website (https://www.pandonia-global-network.org). Pandora data was accessed through the EPA’s RSIG tool (https://www.epa.gov/hesc/remote-sensing-information-gateway; last access April 2025). The TEMPO Level 2, version 3 data is available at NASA Earthdata ASDC website 545 (https://search.earthdata.nasa.gov/). The meteorological data is available at NOAA ISD Lite database (ftp://ftp.ncdc.noaa.gov/pub/data/noaa/isd-lite/). The AERONET AOD data is available via NASA GFSC website (https://aeronet.gsfc.nasa.gov/). This dataset is associated with the following publication: Rawat, P., K. Travis, B. Henderson, J. Crawford, L.M. Judd, M.A. Demetillo, T. Lee, D. Flittner, J. Szykman, L. Valin, A. Whitehill, E. Baumann, T. Hanisco, A. Pandey, G. Abad, C. Nowlan, X. Liu, and K. Chance. Spatiotemporal Assessment of the TEMPO Formaldehyde Column Retrieval Using the Pandonia Global Network. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 131(2): e2025JD044788, (2026).
    4
    4 days ago
  • all input to run the CMAQ model, all files are in netCDF format. This dataset is not publicly accessible because: hosted by the corresponding authors, can be obtained through a request. It can be accessed through the following means: All data is available upon request from the corresponding authors. Format: input for the CMAQ model in netCDF format
    0
    4 days ago
  • Results previously reported by EPA/ORD on the modified method have led to its adoption into a Standard Operating Procedure for labs performing qPCR analyses for E. coli at recreational beaches in the state of Michigan. This dataset provides further documentation of the performance and applicability of the modified method for recreational beach water testing including data from an extensive survey that can be used to determine when and where unacceptable levels of DNA losses may occur with and without this method modification in the Great Lakes region. Please see the attached dataset description document for additional information.
    1
    4 days ago
  • This dataset shows all detailed data backing up all results (tables, figures, results text) shown in the main paper and supplemental files of the paper intended for submission to Environmental Science and Pollution Research "Acute BTEX Inhalation Activates Sensitive Transcriptomic Pathways in Mouse Respiratory Tract" by T. W. Jackson et al.
    6
    4 days ago
  • This data file contains Python scripts for recreating the analysis presented in the manuscript. The manuscript figures are also included in this file. This dataset is associated with the following publication: Kelleher, M.K., P.E. Morefield, and K.M. Grise. Relationships Between Atmospheric Circulation and Southwestern United States 21st Century Precipitation Trends in Statistically Downscaled CMIP6 Models. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 131(6): e2025JD044419, (2026).
    1
    4 days ago
  • Supplementary data for "Leveraging invasive mussel contaminant survey data for stepwise prioritization of chemicals of potential concern in the Great Lakes basin". This dataset is associated with the following publication: Fuller, N., K. Kimbrough, M. Edwards, E. Maloney, S. Corsi, M. Pronschinske, L. DeCicco, J. Frisch, A. Baldwin, S. Hummel, N. Garcia Reyero, and D. Villeneuve. Leveraging invasive mussel contaminant survey data for stepwise prioritization of chemicals of potential concern in the Great Lakes basin. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(7): 2070-2087, (2025).
    1
    4 days ago
  • Supplementary data for "Derivation and characterization of environmental hazard concentrations for chemical prioritization: a case study in the Great Lakes tributaries". This dataset is associated with the following publication: Maloney, E., S. Corsi, M. Pronschinske, L. DeCicco, M. Nott, J. Frisch, N. Fuller, A. Baldwin, K. Kimbrough, M. Edwards, S. Hummel, N. Vinas, and D. Villeneuve. Derivation and characterization of environmental hazard concentrations for chemical prioritization: a case study in the Great Lakes tributaries. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(7): 2029-2047, (2025).
    2
    4 days ago
  • Data and code for Olson et al. Algal blooms in lakes increase after wildfire smoke events in the contiguous United States. This dataset is associated with the following publication: Olson, N.E., M.M. Brehob, R.D. Sabo, I. Pavlovic, K.I. Shank, S. Penry, A.M. Handler, M.J. Pennino, R.B. Rice, K.L. Boaggio, and S.D. LeDuc. Algal Blooms in Lakes Increase After Wildfire Smoke Events in the Contiguous United States. Global Change Biology Communications. John Wiley & Sons, Inc., Hoboken, NJ, USA, 1(1): e70004, (2026).
    3
    4 days ago
  • Supporting information for "Prioritizing Chemical Candidates from Non-targeted Analysis Using Metadata, Spectral Similarity, and Hazard Scoring within INTERPRET NTA"
    2
    4 days ago
  • Pb/As totals and IVBA. This dataset is associated with the following publication: Blackmon, M., T. Sowers, A. Betts, C. Jiang, and K. Bradham. Lead transformation to plumbojarosite remains stable following lime addition for lead and arsenic contaminated soils. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 506: 141540, (2026).
    1
    4 days ago
  • The dataset comprises a high-resolution sediment record spanning 7000 years from Foy Lake (Montana, USA). Foy Lake, situated at 48.1648°N, 114.3589°W and 1005 meters above sea level, is a deep freshwater lake within the drought-prone Flathead River Basin in the northern Rocky Mountains. Researchers collected percent abundances of 109 diatom taxa from a continuous lake sediment core, sampled approximately every 5–20 years, resulting in an extensive 7000-year record captured over 763 time-steps. This dataset is associated with the following publication: Angeler, D., T. Eason, A. Garmestani, and C. Allen. Data sonification offers a novel approach for communicating Earth’s tipping points. Ecology and Society. Resilience Alliance Publications, Waterloo, CANADA, 31(1): 28, (2026).
    1
    4 days ago
  • The data sets include results from analyzing drinking water treatment residuals (DWTRs) collected from 11 drinking water treatment facilities located in the Northeast Region. The goal of analyzing DWTRs are to understand their phosphorus (P) removal capacity, arsenic leaching, and PFAS content so that we can better utilize their potential for enhancing stormwater infrastructure in New England to achieve P reduction goal. This dataset is associated with the following publication: Kubow, M., T. Chin, A. Sherman, Y. Yuan, M. Voorhees, A. Traviglia, J. McCord, M. Strynar, S. Hurley, and E. Roy. Phosphorus Removal Capacity, Arsenic Leaching, and PFAS Content of Drinking Water Treatment Residuals with Potential to Enhance Stormwater Infrastructure in New England. Journal of Sustainable Water in the Built Environment. American Society of Civil Engineers (ASCE), New York, NY, USA, 12(2): 1-9, (2026).
    1
    4 days ago
  • Functional Observational Battery raw scores and functional domain scores for acute and sub-chronic data published in: Moser, V. C., Cheek, B. M., & MacPhail, R. C. (1995). A multidisciplinary approach to toxicological screening: III. Neurobehavioral toxicity. Journal of Toxicology and Environmental Health, Part A Current Issues, 45(2), 173-210.
    1
    4 days ago
  • NWCA 2016 Data. This dataset is associated with the following publication: Dumelle, M., R. Trangucci, A. Nahlik, T. Olsen, K. Irvine, K. Blocksom, J. Ver Hoef, and C. Fuentes. Missing data in ecology: Syntheses, clarifications, and considerations. ECOLOGICAL MONOGRAPHS. Ecological Society of America, Ithaca, NY, USA, 95(4): e70037, (2025).
    1
    4 days ago
  • In this study, we present a prototype roadmap for integrating remotely sensed observations into decision-making frameworks. Using OPERA VLM products derived from Sentinel-1, we map VLM rates and uncertainties at ~30 m resolution across the Greater Houston-Galveston region.. Our analysis reveals widespread but spatially varying subsidence, with differing impacts on ASTs. We apply a metric to estimate that VLM from April 2016 to November 2023 is predominantly linear, allowing future extrapolation of VLM rates. Combining future sea-level rise (SLR) scenarios with VLM data, we estimate that by 2050, ASTs in the region will experience at least 26.1 cm of relative SLR, with 10 (14.9%) exposed to more than 60 cm. Finally, we illustrate the value of integrating hydrodynamic models with spatially varying relative SLR, finding that flooding hazards are substantially amplified during a simulated Hurricane Harvey–like event under future conditions. Overall, we demonstrate the importance of incorporating high-resolution VLM data into hazard assessments to support near- and long-term decision-making. Our approach provides actionable insights for enhancing resilience to subsidence, RSLR, and associated flooding risks in Greater Houston/Galveston and other vulnerable coastal areas. This dataset is not publicly accessible because: Non EPA generated data generated by NASA. It can be accessed through the following means: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. InSAR processing software is freely available on GitHub and archived on Zenodo. ISCE-2 is at https://github.com/isce-framework/isce2 and https://zenodo.org/record/8157051, FRInGE is at https://github.com/isce-framework/fringe/tree/main, and https://zenodo.org/record/8157065, and MintPy is at https://github.com/insarlab/MintPy and https://zenodo.org/record/7502839, GNSS data and MIDAS rates and uncertainties are available from the Nevada Geodetic Lab at http://geodesy.unr.edu. Sentinel-1 single look complex images (SLC) are available at the Alaska Satellite Facility Distributed Active Archive Center (https://asf.alaska.edu/). The rate and associated uncertainty map produced in this work are available in the supplementary files in both geotiff and kmz (Google Earth) format. The historical flood depth model prediction is available at https://datadryad.org/stash/dataset/doi:https://doi.org/10.7280/D1NX1W (H10.tif), and the future flood depth model prediction is available in the supplementary files in geotiff format. Format: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. InSAR processing software is freely available on GitHub and archived on Zenodo. ISCE-2 is at https://github.com/isce-framework/isce2 and https://zenodo.org/record/8157051, FRInGE is at https://github.com/isce-framework/fringe/tree/main, and https://zenodo.org/record/8157065, and MintPy is at https://github.com/insarlab/MintPy and https://zenodo.org/record/7502839, GNSS data and MIDAS rates and uncertainties are available from the Nevada Geodetic Lab at http://geodesy.unr.edu. Sentinel-1 single look complex images (SLC) are available at the Alaska Satellite Facility Distributed Active Archive Center (https://asf.alaska.edu/). The rate and associated uncertainty map produced in this work are available in the supplementary files in both geotiff and kmz (Google Earth) format. The historical flood depth model prediction is available at https://datadryad.org/stash/dataset/doi:https://doi.org/10.7280/D1NX1W (H10.tif), and the future flood depth model prediction is available in the supplementary files in geotiff format. This dataset is associated with the following publication: Buzzanga, B., M. Govorcin, F. Kremer, J.E. Schubert, D.P.S. Bekaert, B. Schaeffer, P. Milillio, A.J. Williams, B.F. Sanders, A.L. Handwerger, and S. Staniewicz. Satellite-based vertical land motion for infrastructure monitoring: a prototype roadmap in Greater Houston, Texas. NATURE. Nature Portfolio, Berlin, GERMANY, 17041, (2025).
    0
    4 days ago
  • Data from paper, "The effects of cadmium and high fructose diet on metabolic and reproductive health in female CD-1 mice.". This dataset is associated with the following publication: Adams, V., J. Dye, M. Narotsky, M. Moore, H. Nguyen, A. Sasser, K. Das, L. Strader, J. Pancras, D. Jenkins-Hill, C. Davis, W. Williams, R. Grindstaff, W. Padgett, C. Lau, and C. Miller. The effects of cadmium and high fructose diet on metabolic and reproductive health in female CD-1 mice.. FOOD AND CHEMICAL TOXICOLOGY. Elsevier Science Ltd, New York, NY, USA, 206: 115726, (2025).
    1
    4 days ago
  • This dataset includes LCMS cyanobacteria results for the spring 2025 Puget Sound aqueous and solid phase adsorption toxin tracking (SPATT) samples.
    1
    4 days ago
  • This dataset is associated with a study published in Water (Water 2025, 17, 2228. https:// doi.org/10.3390/w17152228). This dataset is associated with the following publication: Jalowska, A., D. Line, T. Spero, J. Kirki-Fox, B. Doll, J. Bowden, and G. Gray. Assessing Flooding from Changes in Extreme Rainfall: Using the Design Rainfall Approach in Hydrologic Modeling. WATER. MDPI, Basel, SWITZERLAND, 17(15): 2228, (2025).
    18
    4 days ago
  • Cyanobacteria forecast results from 2021-2023 for 2,192 satellite resolvable lakes. This dataset is associated with the following publication: Meyers, K., B. Schaeffer, O. Cronin Golomb, W. Salls, D. Benkendorf, G. Serenbetz, and M. Coffer. National forecasting of cyanobacterial harmful algal bloom events: a three-year model evaluation. LAKE AND RESERVOIR MANAGEMENT. Taylor & Francis Group, London, UK, 41(4): 261-269, (2026).
    1
    4 days ago
  • The AQUATOX model (Release 3.2, https://www.epa.gov/hydrowq/aquatox) was parameterized and applied to The Loch in Loch Vale watershed in Colorado. The data were provided by the USGS supported Loch Vale Watershed Long-term Ecological Research and Monitoring program. This dataset is associated with the following publication: Clough, J., B. Rashleigh, R. Parmar, K. Wolfe, C. Knightes, and D. Smith. Modeling water quality in a subalpine lake. ECOLOGICAL MODELLING. Elsevier Science BV, Amsterdam, NETHERLANDS, 507: 111172, (2025).
    3
    4 days ago
  • Compliance refinery fenceline monitoring data for benzene across the United States during 2019. This dataset is associated with the following publication: Mukerjee, S., C. Croghan, and L. Smith. Examination of compliance refinery fenceline monitoring for benzene across the United States during 2019. Atmospheric Pollution Research. Turkish National Committee for Air Pollution Research and Control, Izmir, TURKEY, 17(2): 102776, (2026).
    2
    4 days ago
  • The dataset contains links to publicly available CMAQ code, CMAQ-ready inputs, and other data used in Kim, H., Walters, W. W., Pye, H.O.T., Foley, K. M., and Hastings, M.G., Detailing Atmospheric Nitrate Chemistry in the Northeastern US Under a Period of Changes in Emissions, Environ. Sci. Technolo., https://doi.org/10.1021/acs.est.5c16699, 2026. This dataset is associated with the following publication: Kim, H., W. Walters, H. Pye, K. Foley, and M. Hastings. Detailing Atmospheric Nitrate Chemistry in the Northeastern US Under a Period of Changes in Emissions. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 60(5): 4289-4297, (2026).
    4
    4 days ago
  • This effort was part of a multi-laboratory study coordinated by HESI. Shafer lab tested multiple chemicals using MEA apparatus. The data was sent to HESI for analysis for the ability of MEA technology to identify seizurogenic potential.
    1
    4 days ago
  • Gene counts in brainstem and livers from mice treated for 5 days with oral anatoxin-a (2, 4, and 6mg/kg/day). Tissues were collected 2 weeks after the completion of treatment.
    3
    4 days ago
  • Data availability for GeoHealth journal publication "Effects of ozone-depleting substances on ultraviolet radiation and skin cancer rates in Australia and the United States of America" by Julia Lee-Taylor, Zeyu Hu, Jessica Kyle, Ken Karipidis, Stuart Henderson, Robert Landolfi, Christopher M. Tasich, and Sasha Madronich. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • Municipal wastewater treatment case studies: These two full scale studies describes the steps and advantages of peracetic acid and chlorination combination for treating wastewater. This dataset is associated with the following publication: Namboodiri, V., and A. Garg. Enhanced Inactivation of E. coli and Enterococci through Dual Disinfection with PAA and Chlorine: Two Full-Scale Wastewater Treatment Case Studies. JOURNAL OF ENVIRONMENTAL ENGINEERING. American Society of Civil Engineers (ASCE), Reston, VA, USA, 152(4): 05026002, (2026).
    2
    4 days ago
  • Supplementary information for "Examining the effects of analytical replication on data quality in a non-targeted analysis experiment".
    1
    4 days ago
  • Temperature data utilized in "A novel framework for expanding temperature intensity-duration-frequency curve utility" by Tierney et al. (https://doi.org/10.1007/s11069-025-07811-1) is available from the NOAA National Centers for Environmental Information Global Surface Hourly Temperature dataset (2001), which is openly available at the following URL: https://www.ncei.noaa.gov/access/search/data-search/global-hourly. This dataset is associated with the following publication: Tierney, G., M. Mallard, T. Spero, and A. Jalowska. A novel framework for expanding temperature intensity-duration-frequency curve utility. Natural Hazards. Springer, Heidelburg, GERMANY, 122: 5, (2026).
    1
    4 days ago
  • This data set includes the supporting documentation for a paper titled A novel approach for quantifying elongated airborne mineral particles (EMPs) using an automated scanning electron microscope (SEM). Citation information for this dataset can be found in Data.gov's References section.
    4
    4 days ago
  • Supporting information for "Nontargeted Analysis of Surface and Groundwaters Impacted by Historic PFAS Waste Sites"
    5
    4 days ago
  • The data presented in this data file is a product of a journal publication. The dataset contains the concentrations of FTOHs measured along with the statistic analysis results derived from the data. This dataset is associated with the following publication: Eichler, C., H. Calder, B. Chandramouli, M. Curtis, H. Hayes, B. Kim, R. Marfil-Vega, C. Mejías, L. Miles, A. Owens, J. Stuff, K. Thaxton, J. Vandenberg, N. Watson, D. Wevill, J. Whitecavage, and X. Liu. Measuring fluorotelomer alcohols by thermal desorption-gas chromatography-tandem mass spectrometry: Interlaboratory study results. JOURNAL OF CHROMATOGRAPHY A. Elsevier Science Ltd, New York, NY, USA, 1769: 466725, (2026).
    1
    4 days ago
  • The data presented in this data file is a product of a journal publication. The dataset contains the concentrations of inadvertently generated PCBs (iPCBs) measured in consumer products along with measured iPCB lake water leaching rates. This dataset is associated with the following publication: Frauenheim, M., X. Liu, K. Woodward, M. Mullin, B. Nickel, M. Aguilar, K. Philpott, and E. Folk IV. Laboratory investigation of inadvertently generated PCBs released from consumer products into lake water. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 503: 140974, (2026).
    1
    4 days ago
  • Dataset includes water quality measurements from coupled stream-beach system. This dataset is associated with the following publication: Lowry, S., A. Diedrich, E. Lum, and O. Shanks. Occurrence of novel human tomato brown rugose fruit virus and conventional microbial source tracking genetic markers in a Hawaiian coupled stream-beach system. Environmental Science: Processes & Impacts. Royal Society of Chemistry, Cambridge, UK, 28(1): 215-229, (2026).
    1
    4 days ago
  • Geospatial datasets associated with manuscript. Includes boundaries, C-CAP land cover, Enhanced Vegetative Index (EVI), hurricane exposures, tornado exposures, storm surge impact areas, and sea level rise scenarios (1-ft and 2-ft). This dataset is associated with the following publications: Buck, K., C. Van Der Wiele, J. Bousquin, R. Polinsky, R. Ennis, Z. Black, M. McDaniel, and D. Parker. Understanding the Effects of Climate Change on Coastal Wetlands: Implications for Managing Federal Mitigation Banks on Florida’s [USA] Gulf Coast. WETLANDS. The Society of Wetland Scientists, McLean, VA, USA, 45: 107, (2025). Buck, K., J. Bousquin, C. Van Der Wiele, Z. Black, D. Parker, and R. Polinsky. Investigating the impact of sea level rise on coastal wetland mitigation banks and their potential for ecological and coastal community benefits. Presented at Florida Association of Mitigation Bankers (FAMB) 2024 Mitigation Banking Workshop, St. Augustine, FL, USA, 10/17/2024 - 10/18/2024.
    18
    4 days ago
  • This dataset contains metadata and data associated in the manuscript: Exploring improved sample recovery and processing methods targeting Bacillus anthracis spores from vegetation matrices.
    1
    4 days ago
  • Here we provide data from water samples that were collected twice monthly, from April 26, 2021 and April 25, 2024, from sixteen stations throughout the San Juan Bay Estuary, Puerto Rico. The station locations are given in Fig. 1 and the descriptions of the data headers in the dataset are given in Table 1 in the associated Read Me file. An overview of methods follows. For methodological details, please see Oczkowski et al. 2026, Water column biogeochemistry in a tropical estuary. This dataset is associated with the following publication: Oczkowski, A., I. Cappielo-Cosme, M. Schwartz, N. Soto Nieves, M. Molina, E. Villafane, E. Huertas, D. Katz, and A. Hanson. Water column biogeochemistry in a tropical urban estuary. JOURNAL OF TROPICAL ECOLOGY. Cambridge University Press, Cambridge, UK, 42: e2, (2026).
    1
    4 days ago
  • Daily Averaged Ammonia Emissions from Barns at Swine Grow-Finish Operations and Corresponding Environmental, Production and Management Conditions. This dataset is associated with the following publication: Rumsey, I., M. Nash, and J. Walker. Estimating air emissions from animal production in the United States using statistical models: Ammonia emissions from swine grow-finish barns. Atmospheric Environment: X. Elsevier B.V., Amsterdam, NETHERLANDS, 29: 100404, (2026).
    1
    4 days ago
  • This entry provides information on how to obtain the data for the manuscript entitled "Environmentally Persistent Free Radicals in Outdoor Surface Grime during Pollen Season". This dataset is not publicly accessible because: Data is maintained by Stephanie Schneider. It can be accessed through the following means: Data can be accessed by contacting Stephanie Schneider at stephanie.schneider@uleth.ca . Format: Data details and format can be obtained from the corresponding author, Stephanie Schneider. This dataset is associated with the following publication: Schneider, S., A. Holder, and S. Styler. Environmentally Persistent Free Radicals in Outdoor Surface Grime during Pollen Season. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 12(9): 1211-1217, (2025).
    0
    4 days ago
  • Data represents satellite derived measures of cyanobacteria biomass across largest US lakes. This dataset is not publicly accessible because: Already publicly available at link below. It can be accessed through the following means: Original satellite files are publicly available at https://oceancolor.gsfc.nasa.gov/about/projects/cyan/. Format: GeoTIFF data, HE5 files. This dataset is associated with the following publication: Coffer, M., B. Schaeffer, W. Salls, J. Minucci, and O. Cronin-Golomb. Recommendations for temporal aggregation of water quality data from multi-platform satellite constellations. INTERNATIONAL JOURNAL OF REMOTE SENSING. Taylor & Francis, Inc., Philadelphia, PA, USA, 47(1): 177-199, (2026).
    0
    4 days ago
  • Summary of rain event date, rainfall depth, and volumetric water content. This dataset is associated with the following publication: Nissen, K., M. Borst, and E. Fassman-Beck. Bioretention Flow-Through Planter Performance and Design Considerations. Journal of Sustainable Water in the Built Environment. American Society of Civil Engineers (ASCE), New York, NY, USA, 12(2): 04025018, (2026).
    1
    4 days ago
  • Plasma oxylipins concentrations in subjects who had either high or low omega-3 fatty acids intake. This dataset is associated with the following publication: Chen, H., S. Zhang, X. Pan, A. Schneider, D. Diazsanchez, J. Samet, and H. Tong. Omega-3 Fatty Acid Intake and Oxylipin Production in Response to Short-Term Ambient Air Pollution Exposure in Healthy Adults. Toxics. MDPI, Basel, SWITZERLAND, 13(12): 1063, (2025).
    1
    4 days ago
  • Posttest and course evaluation data obtained by users that completed and received continuing education credit for the Wildfire Smoke and Your Patients' Health webcourse. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: CDC’s Training and Continuing Education Online (TCEO) program in the National Center for State, Tribal, Local, and Territorial Public Health Infrastructure and Workforce. Format: Completing the course led to users obtaining continuing education credits. Therefore, in addition to registration information allowing for them to receive credit, all users provided required information about their geographic location (city, state, and zip code), educational attainment, and type of continuing education credit to be received. This dataset is associated with the following publication: Dowling, T.C., S.L. Stone, W.E. Cascio, S.A. Damon, M.R. Hutson, J.D. Sacks, and M.C. Mirabelli. Assessment of a Continuing Education Course about Wildfire Smoke and Patient Health. ATS Scholar. American Thoracic Society, New York, NY, USA, 6(4): 442-447, (2025).
    0
    4 days ago
  • The attached excel file contains all the raw values used to generate the means and standard deviations/errors in all tables and figures in the manuscript. This dataset is associated with the following publication: Rentschler, K., W.K. Martin, W. Oshiro, M. Schladweiler, T. Jackson, W. Cascio, U. Kodavanti, P. Evansky, C. Lambright, R. Strader, J. Conley, W. Williams, D. Freeborn, C. Miller, R. Grindstaff, M. Monsees, A. Lewis, D. Herr, P.R. Kodavanti, M. Hazari, and A. Farraj. Sleep disruption from inhalation of biomass smoke: a basis for coincident hypertension?. Particle and Fibre Toxicology. BioMed Central Ltd, London, UK, 22: 34, (2025).
    1
    4 days ago
  • Data on invertebrate assemblages from thirty sites in western Oregon sampled post-wildfire. This dataset is associated with the following publication: Swartz, A., A. Coble, B. Penaluna, R. Flitcroft, J. Ebersole, and M. Krawchuk. Following megafires fishes thrive and amphibians persist even in severely burned watersheds. Communications Earth & Environment. Springer Nature, LONDON, UK, 6: 945, (2025).
    1
    4 days ago
  • Efforts to quantify and explain individual size distributions (ISD) are prominent in ecological research and potentially for applications to management which increasingly consider ecosystem-scale objectives. We use a nation-wide database of individual size measurements for United States stream fishes paired with species’ traits and test for direct and indirect effects of traits, flow, and land use on the slope of the interspecific ISD. Modeling results show that traits have strong, direct effects on ISD whereas flow and land use primarily indirectly affect ISD via mediation by functional traits. ISDs flatten (i.e., greater abundances of larger-bodied individuals) when environmental conditions favor higher trophic levels, thermal tolerances, and periodic life histories, but steepen (i.e., greater abundances of smaller-bodied individuals) when environments benefit opportunistic life histories. Our framework that incorporates direct and indirect of traits, flow alteration, and land-use on ISD could be expanded to incorporate additional variables that interact with flow regimes (e.g., temperature, physical habitat) to understand and predict how multiple environmental stressors affect ecosystem functions. This dataset is associated with the following publication: Woods, T., D. McGarvey, M. Cashman, M. Meador, D. Carlisle, K. Eng, D. Kopp, and K. Maloney. Integrating theory and empirical patterns: Fish body size distributions, life history traits, and environmental flows in streams. Science Advances. American Association for the Advancement of Science (AAAS), Washington, DC, USA, 11(51): eadu4026, (2025).
    1
    4 days ago
  • Results for PFOS analysis with detailed methods. This dataset is associated with the following publication: Wang, Y., H. Jang, M. Topel, S. Dasetty, Y. Liu, M. Ateia, A. Tam, V. Rozyyev, E. Ouyang, W. Zhuang, H. Pu, S.S. Lee, X. Sui, J.W. Elam, A.L. Ferguson, S.B. Darling, and J. Chen. Reversible parts-per-trillion-level detection of perfluorooctane sulfonic acid in tap water using field-effect transistor sensors. Nature Water. Nature Portfolio, Berlin, GERMANY, 3: 1187-1197, (2025).
    1
    4 days ago
  • This dataset contains the site clusters identified from a Bayesian network analysis with data clustering. Original data used for identifying clusters came from the Region 4 urban background study located at https://www.epa.gov/risk/regional-urban-background-study. This dataset is associated with the following publication: Carriger, J.F., R.G. Ford, T. Frederick, S. Chan, and Y. Fung. Classifying Metal Soil Concentrations with Bayesian Networks: Urban Background in the Southeastern United States. ENVIRONMENTAL MODELING AND ASSESSMENT. Baltzer Science Publishers BV, Bussum, NETHERLANDS, 30: 981-998, (2025).
    2
    4 days ago
  • Dataset for evaluating the impacts of brick-kiln emissions on fine particles. This dataset is associated with the following publication: Sarwar, G., F. Sidi, B. Henderson, C. Hogrefe, B. Murphy, R. Mathur, D. Kang, G. Pouliot, K. Talgo, S. Ahmed, A. Sharma, and C. Venkataraman. Evaluating the impacts of brick-kiln emissions on fine particles. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 363: 121597, (2025).
    11
    4 days ago
  • Supplemental materials for "EcoToxChip provides insights into pathway perturbation upon chlorantraniliprole exposure to larval fathead minnow". This dataset is associated with the following publication: Brickley, M., J. Collins, J. Cavallin, D. Villeneuve, and C. LaLone. EcoToxChip provides insights into pathway perturbation upon chlorantraniliprole exposure to larval fathead minnow. AQUATIC TOXICOLOGY. Elsevier Science Ltd, New York, NY, USA, 286: 107429, (2025).
    2
    4 days ago
  • N/A. This dataset is associated with the following publication: Hughes, M., M. Devito, G. Patlewicz, R. Thomas, L. Adams, J. Ambroso, X. Yang, B. Upadhyay, S. Burleson, and E. Kenyon. Immunotoxicity of Four Per- and Polyfluoroalkyl Substances Following 28-Day Oral Repeat Dosing in Rats Assessed by the Anti-Sheep Red Blood Cell IgM Response. Toxics. MDPI, Basel, SWITZERLAND, 13(6): 490, (2025).
    1
    4 days ago
  • The EPA Dynamically Downscaled Ensemble (EDDE) Version 2 is a collection of physics-based projections of future conditions, as well as historical simulations, dynamically downscaled from global climate models within the Sixth Coupled Model Intercomparison Project (CMIP6) using the Weather Research and Forecasting (WRF) model. EDDEv2 contains simulations over historical (1985-2014) and future (2025-2099) periods under multiple Shared Socioeconomic Pathways (SSPs) downscaled on a 12-km contiguous U.S. domain. EDDE datasets are produced by EPA/ORD staff and by contract staff who worked under the technical guidance of EPA/ORD staff. Data are in Network Common Data Form (netCDF) and are subset from WRF's output and then written to adhere to principles of Climate and Forecasting System (CF) Compliance, as outlined at https://cfconventions.org. This dataset is associated with the following publication: Mallard, M., T. Spero, J. Bowden, J. Willison, K. Brehme, and L. Reynolds. The Environmental Protection Agency (EPA) Dynamically Downscaled Ensemble (EDDE) version 2: A 3D physics-based dataset for projections of future extreme weather events. Data in Brief. Elsevier B.V., Amsterdam, NETHERLANDS, 63: 112070, (2025).
    2
    4 days ago
  • The dataset contains publicly available data on PM2.5 concentrations from air quality monitors as well as electronic health records from the National COVID Cohort Collaborative. The data is stored in tabular format. This dataset is not publicly accessible because: The data contains PII and PHI which cannot be included in ScienceHub or exported from their secure environment. It can be accessed through the following means: The data can be accessed through the National COVID Cohort Collaborative (now called the National Clinical Cohort Collaborative; https://covid.cd2h.org/). Format: The dataset contains publicly available data on PM2.5 concentrations from air quality monitors as well as electronic health records from the National COVID Cohort Collaborative. The data is stored in tabular format. This dataset is associated with the following publication: Ward-Caviness, C., A. Platt, E. Fisher, A. Weaver, M. Bell, and M. Bravo. A case-crossover analysis of short-term PM2.5 exposure and COVID19-related hospitalizations in the National Clinical Cohort Collaborative. Nature Communications. Nature Portfolio, Berlin, GERMANY, 5: 459, (2025).
    0
    4 days ago
  • These data include sample information and gene sequence reads for amplicon sequence variants from a study of freezing and storage duration effects on diatom-environment relationships. This dataset is associated with the following publication: Smucker, N., E. Pilgrim, C. Nietch, and C. Carpenter. Freezing periphyton samples and storage duration do not affect the use of diatom DNA metabarcoding to determine effects of stressors on streams. ENVIRONMENTAL MONITORING AND ASSESSMENT. Springer, New York, NY, USA, 197: 1360, (2025).
    1
    4 days ago
  • Supplementary materials for "Non-Targeted Analysis (NTA) of Plasma and Liver from Sprague Dawley Rats Exposed to Perfluorohexanesulfonamide (PFHxSA), a Precursor to Perfluorohexane Sulfonic Acid (PFHxS)"
    1
    4 days ago
  • Actual and model emission data from grassland burns. This dataset is associated with the following publication: Josephson, A., J. Aurell, S. Cohen, T. Walton, R. Linn, and B. Gullett. Impact of grassland fire dynamics on particulate emission factors. Fire Safety Journal. Elsevier B.V., Amsterdam, NETHERLANDS, 158: 104554, (2025).
    2
    4 days ago
  • Supplementary files for "Impact of gut permeability on estimation of oral bioavailability for chemicals in commerce and the environment"
    2
    4 days ago
  • The United States Environmental Protection Agency’s National Nutrient Inventory provides estimates of major agricultural, urban, atmospheric, and natural nutrient fluxes for the contiguous US at county and HUC12 scales from 1987 (from 1950 for agriculture) to 2017. We recommend using the attached HUC12 shapefiles which correspond with the HUC12 datasets provided. Portions of this dataset are inaccessible because: NA. They can be accessed through the following means: NA. Format: NA
    6
    4 days ago
  • Title/abstract screening tags for nature-based solutions and health literature published 2000-2023.
    1
    4 days ago
  • These data describe were derived from a study that evaluated the use of wearable sensors for monitoring the real-time health of individuals wearing PPE to mitigate risk of developing an HRI and enable timely intervention. This dataset is associated with the following publication: Hegarty-Craver, M., D. Womack, J. Thornburg, T. Boe, M.J. Archer, and W. Calfee. Predicting Risk of Heat-Related Injuries for Individuals Wearing Personal Protective Equipment Using Smartwatches: Feasibility Observational Study. JMIR Formative Research. JMIR Publications, Toronto, CANADA, 9: e72324, (2025).
    1
    4 days ago
  • The updates to the NEWR model are developed and used to evaluate the impacts of different Log Reduction Targets (LRTs) on system cost and various environmental impacts in implementing non-potable water reuse systems. This dataset is associated with the following publication: Arden, S., K. McGaughy , B. Morelli, M. Jahne, X.C. Ma, and J. Garland. Balancing human health protection with sustainable design in water reuse: how do log reduction targets affect system cost and environmental impacts?. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 12(11): 1510-1515, (2025).
    4
    4 days ago
  • Links to Figshare and CRAN files for "Brown, E.A., Hellenthal, R.A., Mahon, M.B. et al. Range maps and waterbody occupancy data for 1158 freshwater macroinvertebrate genera in the contiguous USA. Sci Data 11, 993 (2024). https://doi.org/10.1038/s41597-024-03845-5". This dataset is associated with the following publication: Brown, E., R. Hellenthal, M. Mahon, S. Rumschlag, and J. Rohr. Range maps and waterbody occupancy data for 1158 freshwater macroinvertebrate genera in the contiguous USA. Scientific Data. Springer Nature, LONDON, UK, 11(1): 993, (2024).
    10
    4 days ago
  • Batch experiments were conducted with strong-base anion exchange (SBA) resins using centrifugal stirrer devices to accurately determine intraparticle mass transfer coefficients (Ds) by reducing external mass transfer resistance. Nitrate was used as a model ion to validate the method and nitrate Ds were obtained for three SBA resins. This dataset is associated with the following publication: Smith, S., B. Gray, E. Hughes, L. Haupert, I. Bass, E. Kleiner, B. Burkhart, S. Pedigo, J. Quinn, G. Abulikemu, J. Pressman, G. Sorial, and D. Wahman. Estimating Ion Exchange Resin Intraparticle Diffusion Coefficients: Method Development and Nitrate Application. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 7(5): e70042, (2025).
    1
    4 days ago
  • Data from manuscript entitled: "Implications for modeling anion exchange treatment of perfluoroalkyl substances in drinking water and related natural organic impacts: a pilot study". This dataset is associated with the following publication: Smith, S., D. Wahman, E. Kleiner, B. Gray, T. Sanan, E. Stebel, C. Gastaldo, E. Hughes, S. Pedigo, B. Datsov, M. Lathrop-Allen, I. Bass, J. Quinn, G. Abulikemu, J. Pressman, G. Sorial, and L. Haupert. Implications for modeling anion exchange treatment of perfluoroalkyl substances in drinking water and related natural organic impacts: a pilot study. WATER RESEARCH. Elsevier Science Ltd, New York, NY, USA, 288: 124685, (2026).
    1
    4 days ago
  • This dataset provides data files and software regarding the report "EVALUATIONS IN SUPPORT OF THE DEVELOPMENT OF AQUATIC LIFE CRITERIA FOR MAJOR GEOCHEMICAL IONS: TOTAL ION TOXICITY VERSUS CALCIUM FOR SEVERAL AQUATIC SPECIES". This includes eight excel files containing data on multiple tests (of different salts, salt mixtures, and test conditions) regarding the acute toxicity of major geochemical ions to eight aquatic species. These data provide the chemistry of test solutions at median lethal conditions in these tests and were used in subsequent analyses described in the report to derive the relationships for total ion toxicity versus calcium concentration for these eight species (for subsequent use in criteria development). A Word file describing these files is provided, and additional files regarding the analyses are archived and subject to request. The dataset also provides two zip files containing software used in these analyses, including software for determining concentration-response curves (to quality assure author-reported LC50s during report preparation) and the software for establishing the total ion toxicity vs calcium relationships. Each zip file contains an executable file and the Fortran code used to build these executables for code review as desired, but are not recompilable into a new executables without Winteracter (a Fortran-based user interface development application). This dataset is associated with the following publication: Erickson, R. Evaluations in support of the development of aquatic life criteria for major geochemical ions: Total ion toxicity versus calcium for several aquatic species. U.S. Environmental Protection Agency, Washington, DC, USA, 2025.
    11
    4 days ago
  • Anatoxin levels in mouse tissues after a single exposure and collected at various timepoints
    2
    4 days ago
  • This dataset contains the EPA-generated CMAQ model data contributed to support the externally-led analysis in the manuscript "Operational, Diagnostic and Probabilistic Evaluation of AQMEII-4 Regional Scale Ozone Dry deposition. Time to Harmonise Our LULC Masks". This dataset is associated with the following publication: Kioutsioukis, I., C. Hogrefe, P. Makar, U. Alyuz, J. Bash, R. Bellasio, R. Bianconi, T. Butler, O. Clifton, P. Cheung, A. Hodzic, R. Kranenburg, A. Lupascu, K. Momoh, J.L. Perez-Camaño, J. Pleim, Y. Ryu, R. San Jose, D. Schwede, R. Sokhi, and S. Galmarini. Operational, diagnostic, and probabilistic evaluation of AQMEII-4 regional-scale ozone dry deposition: time to harmonize our LULC masks. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(20): 12923–12953, (2025).
    1
    4 days ago
  • Supplementary data for "Comparison of whole transcriptome and targeted RNA sequencing for ecological high-throughput transcriptomics". This dataset is associated with the following publication: Villeneuve, D., M. Nash, A. Biales, K. Bush, G. Evensen, L. Everett, J. Haselman, M. Hazemi, M. Le, H. Poynton, B. Seligmann , L. Wehmas, J. Yeakley, and K. Flynn. Comparison of whole transcriptome and targeted RNA sequencing for ecological high-throughput transcriptomics. REGULATORY TOXICOLOGY AND PHARMACOLOGY. Elsevier Science Ltd, New York, NY, USA, 162: 105898, (2025).
    3
    4 days ago
  • Dataset for journal article, Improved Simulation of Particle Number Concentrations Over the US: Integrating a Size-Resolved Advanced Particle Microphysics Model Into CMAQ. Observed aerosol number concentrations, particle size distributions, and CCN are available via F. Yu, Luo, et al. (2020), Marinescu et al. (2019), and Perkins et al. (2022). Part of data of particle size distributions and number concentrations were accessed at https://ebas-data.nilu.no/Default.aspx and https://csl.noaa.gov/groups/csl7/measurements/2013senex/. Figures were plotted using MATLAB R2023b and NCAR Command Language (NCL) version 6.3.0. MATLAB is available under its license at https://www.mathworks.com/products/matlab.html and NCL can be accessed under its license at https://www.ncl.ucar.edu/. This dataset is not publicly accessible because: Lead is outside of EPA and only EPA author is no longer with the Agency. It can be accessed through the following means: Contact the corresponding author of the journal article, Dr. Fangqun Yu, fyu@albany.edu. Format: Dataset details not available. This dataset is associated with the following publication: Mao, J., F. Yu, B. Murphy, J. An, Y. Zhang, G. Luo, S. Lin, and A.G. Hallar. Improved Simulation of Particle Number Concentrations Over the US: Integrating a Size-Resolved Advanced Particle Microphysics Model Into CMAQ. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 130(16): e2025JD044021, (2025).
    0
    4 days ago
  • This dataset contains a link to the public EPA CRACMM github repository and an update (zip file) that will be put into the repo.
    2
    4 days ago
  • There are four studies used in this work: 1) Idaho Falls Roadway Study 2) Caltrans 99 Highway Study, 3) GM Sulfate Dispersion Experiment, and 4) the Berkeley Freeway Experiment. In all cases, the data used from the studies consist of concentration measurements of Sulfur Hexafluoride (SF6) released as a tracer to simulate roadway emissions and meteorological measurements. Comparisons are made to the various source formulations in AERMOD, the EPA’s preferred Gaussian dispersion model. This dataset is not publicly accessible because: This is non-EPA data. It can be accessed through the following means: 1) Idaho Falls Roadway Study. The data will be posted to https://www.epa.gov/scram in the future. In the meantime, contact Clint Tillerson (EPA) by email: tillerson.clint@epa.gov. 2) Caltrans 99 Highway Study. The data is available in the CALINE4 manual (accessible here: https://www.weblakes.com/products/calroads/resources/docs/CALINE4.pdf). 3) GM Sulfate Dispersion Experiment. The data will be posted to https://www.epa.gov/scram in the future. In the meantime, contact Clint Tillerson (EPA) by email: tillerson.clint@epa.gov. 4) Berkeley Freeway Experiment. The data is available here: https://nap.nationalacademies.org/catalog/27183/assessing-air-pollution-dispersion-models-for-emissions-regulation. Format: The format of the data varies by study as described in the data dictionary. This dataset is associated with the following publication: Owen, C., D. Heist, M. Snyder, R. Miller, L. Kent, M. Buechlein, and E. Carr. Incorporation of RLINE into AERMOD: An update and evaluation for mobile source applications. JOURNAL OF THE AIR & WASTE MANAGEMENT ASSOCIATION. Air & Waste Management Association, Pittsburgh, PA, USA, 75(4): 304-321, (2025).
    0
    4 days ago
  • The dataset includes the accession numbers to the RNA sequences and qPCR data for pathogens and validation of some important RNA sequences. This dataset is associated with the following publication: Lu, J., I. Struewing, and N. Ashbolt. Meta-Transcriptomic Response to Copper Corrosion in Drinking Water Biofilms. Microorganisms. MDPI, Basel, SWITZERLAND, 13(7): 1528, (2025).
    1
    4 days ago
  • Study reports for "Subchronic Toxicities of Four Per- and Polyfluoroalkyl Substances (PFASs) by Oral Exposure in Sprague–Dawley Rats". This dataset is associated with the following publication: Kenyon, E., M. Devito, G. Patlewicz, L. Adams, R. Thomas, J. Ambroso, X. Yang, J. Blake, B. Upadhyay, J. Furr, and M. Hughes. Subchronic Toxicities of Four Per- and Polyfluoroalkyl Substances (PFASs) by Oral Exposure in Sprague–Dawley Rats. Toxics. MDPI, Basel, SWITZERLAND, 13(7): 524, (2025).
    1
    4 days ago
  • The U.S. Geological Survey (USGS), in partnership with several federal agencies, has now developed and released seven National Land Cover Database (NLCD) products: NLCD 1992, 2001, 2006, 2011, 2016, 2019, and 2021. Beginning with the 2016 release, land cover products were created for two-to-three-year intervals between 2001 and the most recent year. These products provide spatially explicit and reliable information on the Nation’s land cover and land cover change. NLCD continues to provide innovative, consistent, and robust methodologies for production of a multi-temporal land cover and land cover change database. The NLCD 2021 release is update based, so the Land Cover and Impervious Surface products released in 2019 are unchanged and used directly with NLCD 2021 for change analysis though the NLCD timespan. Science products and the change index are updated and will need to be reacquired to contain the additional 2021 change. These new products use a streamlined compositing process for assembling and preprocessing Landsat imagery and geospatial ancillary datasets; a temporally, spectrally, and spatially integrated land cover change analysis strategy; a theme-based post-classification protocol for generating land cover and change products; a continuous fields biophysical parameters modeling method; and a scripted operational system. The overall accuracy of the 2019 Level I land cover was 91%. Results from this study confirm the robustness of this comprehensive and highly automated procedure for NLCD 2021 operational mapping (see https://doi.org/10.1080/15481603.2023.2181143 for the latest accuracy assessment publication). Questions about the NLCD 2021 land cover product can be directed to the NLCD 2021 land cover mapping team at USGS EROS, Sioux Falls, SD (605) 594-6151 or mrlc@usgs.gov. See included spatial metadata for more details.
    1
    4 days ago
  • This is a study on healthcare workers at the University of North Carolina Hospital system conducted during the COVID-19 pandemic in 2020-2021. This includes responses to survey questions on occupation, living situation, mental health, physical health, prior COVID-19 infection, and vaccination status. As the data are identifiable, we cannot release them publicly. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: These data are owned by the University of North Carolina at Chapel Hill. Contact Dr. Emily Ciccone ciccone@med.unc.edu with inquiries. Format: This dataset includes data on healthcare workers, including questionnaire responses and data from wearable tracking devices. These data are sensitive and participants are potentially identifiable.
    0
    4 days ago
  • A full list of non-targeted chemical features found in the study "Examining Chemical Space Coverage of Solid Phase Extraction Methods in Environmental Water for Use with Non-Targeted Analysis Methods." Including all chemical features detected by any of the four included solid phase extraction methods in February 2025 surface water across both ionization modes. Chemical identification candidates can be explored in GitHub with interactive scatterplots (https://alexchao32.github.io/SPE-Coverage-INTA-Visuals-ScatterPlot/) and bar chart visuals (https://alexchao32.github.io/SPE-Coverage-INTA-Visuals-BarCharts/). This dataset is associated with the following publication: Brunelle, L., E. Stebel, A. Batt, A. Chao, and T. Ferland. Examining Chemical Space Coverage of Solid Phase Extraction Methods in Environmental Water for Use with LC-MS Non-Targeted Analysis Methods. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 1002: 180606, (2025).
    1
    4 days ago
  • This dataset contains the air quality model fields used for the analysis presented in manuscript “A Diagnostic Intercomparison of Modeled Ozone Dry Deposition Over North America and Europe Using AQMEII4 Regional-Scale Simulations” (Hogrefe et al., 2025, https://doi.org/10.5194/egusphere-2025-225). This dataset is associated with the following publication: Hogrefe, C., S. Galmarini, P. Makar, I. Kioutsioukis, O. Clifton, U. Alyuz, J. Bash, R. Bellasio, R. Bianconi, T. Butler, P. Cheung, A. Hodzic, R. Kranenburg, A. Lupascu, K. Momoh, J.L. Perez-Camanyo, J. Pleim, Y. Ryu, R. San Jose, M. Schaap, D. Schwede, and R. Sokhi. A diagnostic intercomparison of modeled ozone dry deposition over North America and Europe using AQMEII4 regional-scale simulations. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(19): 12629–12656, (2025).
    1
    4 days ago
  • Food frequency questionnaire data compared to PFAS measurements in serum of pregnant women enrolled in the National Children's Study. This dataset is not publicly accessible because: Data are not available from the authors as they were obtained through Data Use Agreements. It can be accessed through the following means: Create a Data Use Agreement with NCS Vanguard Data and Sample Archive and Access System and the NICHD Data and Specimen Hub (DASH). Format: This manuscript was prepared using National Children’s Study Research Materials obtained from the NCS Vanguard Data and Sample Archive and Access System and the NICHD Data and Specimen Hub (DASH). This dataset is associated with the following publication: Deluca, N., K. Thomas, T. Luben, and L. Melnyk. Associations between self-reported consumption of foods and serum PFAS concentrations in a sample of pregnant women in the United States. ENVIRONMENTAL RESEARCH. Elsevier B.V., Amsterdam, NETHERLANDS, 276: 121461, (2025).
    0
    4 days ago
  • Data extracted from published scientific literature on soil and dust ingestion studies are included in the manuscript in Table S2. It includes age, age grouping, study type, study reference, N, mean, standard error, and 95% confidence intervals. This dataset is associated with the following publication: Cohen, J., H. Hubbard, H. Ozkaynak, K. Thomas, L. Phillips, and N. Tulve. Meta-analysis of soil and dust ingestion studies. ENVIRONMENTAL RESEARCH. Elsevier B.V., Amsterdam, NETHERLANDS, 261: 119649, (2024).
    1
    4 days ago
  • a database of human biomonitoring guidance values. This dataset is not publicly accessible because: It's publicly available at https://www.intlexposurescience.org/i-hbm/. It can be accessed through the following means: go to https://www.intlexposurescience.org/i-hbm/. Format: a database of human biomonitoring guidance values. This dataset is associated with the following publication: Macey, K., R. Lange, P. Apel, D. Poddalgoda, A. Calafat, M. Kolossa-Gehring, J. LaKind, L. Melnyk, S. Nakayama, A. St-Armand, and T. Pollock. Human biomonitoring health-based guidance values: A case study of the HB2GV Dashboard and DEHP. INTERNATIONAL JOURNAL OF HYGIENE AND ENVIRONMENTAL HEALTH. Elsevier B.V., Amsterdam, NETHERLANDS, 263: 114490, (2025).
    0
    4 days ago
  • Links to data for "The Chemical and Products Database v4.0, an updated resource supporting chemical exposure evaluations". This dataset is associated with the following publication: Handa, S., K. Isaacs, J. Wall, A. Larger, S. Burns, L. Koval, K. Baron-Furuyama, C. Elonen, D. Lyons, K. Dionisio, M.B. Horton, and K. Phillips. The Chemical and Products Database v4.0, an updated resource supporting chemical exposure evaluations. Scientific Data. Springer Nature, LONDON, UK, 12: 950, (2025).
    7
    4 days ago
  • The dataset is a emission factor database for open burning, open detonation and static fire of obsolete military ordnance.
    4
    4 days ago
  • We linked anonymous residential parcel information from Regrid with redlining polygons from Mapping Inequality, and assessed how assigning redlining grades from polygons to census tracts, census block groups, and ZIP codes might contribute to exposure misclassification in epidemiologic studies.
    3
    4 days ago
  • Updates to ecohealth relationship browser text and bibliography
    1
    4 days ago
  • This file contains coral reef physical structure summary data collected from 6,016 10m2 stations in the Florida Reef Tract during 2005-2020 that was put together and modified for analysis by William S. Fisher. Data were taken from the Florida Fish and Wildlife Conservation Commission Disturbance Response Monitoring (DRM) Program. A worksheet tab called "File information" contains a description and explanation of the data. This dataset is associated with the following publication: Fisher, W.S., and J.F. Carriger. Patterns in physical structure of coral communities in Florida, USA. CORAL REEFS. Springer, New York, NY, USA, 44: 1495-1512, (2025).
    1
    4 days ago
  • The Github Repository, https://github.com/jodhernandezbe/TRI4PLADS/tree/v1.0.0,, is publicly available and referenced in supplementary information. This GitHub repository describes the computational framework overview, software requirements, model use, model output, and disclaimer. This repository presents a multi-scale framework that combines data engineering with process systems engineering (PSE) to enhance the precision of chemical flow analysis (CFA) at the end-of-life (EoL) stage. The focus is on chemicals used in plastic manufacturing, tracing their flows through the supply chain and EoL pathways. Additionally, this study examines potential discharges from material recovery facilities to publicly owned treatment works (POTW) facilities, recognizing their relevance to human and environmental health. Tracking these discharges is critical, as industrial EoL material transfers to POTWs can interfere with biological treatment processes, leading to unintended environmental chemical releases. By integrating data-driven methodologies with mechanistic modeling, this framework supports the identification, quantification, and regulatory assessment of chemical discharges, providing a science-based foundation for industrial and policy decision-making in sustainable material and water management. The attached file CoU - Metadata File.xlsx contains the datasets to build Figure 3 and describe a qualitative flow diagram of methyl methacrylate from manufacturing to potential consumer products generated from the Chemical Conditions of Use Locator methodology (https://doi.org/10.1111/jiec.13626). The attached file "MMA POTW Dataset.xlsx" contains the datasets needed to run the Chemical Tracker and Exposure Assessor in Publicly Owned Treatment Works Model (ChemTEAPOTW) as described in the Github Repository https://github.com/gruizmer/ChemTEAPOTW. The attached file "Plastic Data-Calculations-Assumptions.docx" contains all calculations and assumption to estimate the methyl methacrylate (MMA) releases from plastic recycling. Finally, users can generate Figures 4 and 5 after following the step-by-step process described in main Github repository for the MMA case study. This dataset is associated with the following publication: Hernandez-Betancur, J.D., J.D. Chea, D. Perez, and G.J. Ruiz-Mercado. Integrating data engineering and process systems engineering for end-of-life chemical flow analysis. COMPUTERS AND CHEMICAL ENGINEERING. Elsevier Science Ltd, New York, NY, USA, 204: 109414, (2026).
    5
    4 days ago
  • A web-browser enabled (HTML) document and Excel file (Water quality parameters and DNA Sequence Reads) that contain detailed data used to inform results presented in publication. This dataset is associated with the following publication: Reschke, E., R. Ennis, and L. Harwell. Using eDNA as a viable fish monitoring approach in Northern Gulf estuarine habitats. ENVIRONMENTAL MONITORING AND ASSESSMENT. Springer, New York, NY, USA, 197: 1145, (2025).
    1
    4 days ago
  • This research effort represents our initial method development research for soil gas, sewer gas, and indoor air samples for PFAS analyses as related to vapor intrusion. The product and associated subsequent products will be consistently updated leading to a constantly expanding database incorporating additional experiments.
    1
    4 days ago
  • Supplemental materials for "Seasonal Stratification Drives Bioaccumulation of Pelagic Mercury Sources in Eutrophic Lakes"
    1
    4 days ago
  • This dataset contains the mid IR spectrum and XRD pattern of synthesized pyromorphite and the Pb, P, Cl, pH and EC measurements for the solubility batch reactions. This dataset is associated with the following publication: Chevis, D., Y. Wan, and K. Scheckel. An integrated experimental and modeling approach to understand pyromorphite solubility. CHEMOSPHERE. Elsevier Science Ltd, New York, NY, USA, 388: 144694, (2025).
    8
    4 days ago
  • Data available in Zenodo via doi: 10.5281/zenodo.16318572 Headwater streams play critical roles in hydrologic and biogeochemical processes and functions, yet their spatial distribution and land cover context remain poorly understood at continental scales. Building from a high-resolution conterminous United States (CONUS) hydrography network dataset, we quantified the spatial extent, density, and upstream catchment characteristics of headwater stream segments across the CONUS. We identified approximately 8.4 million kilometers of headwater streams – 77% of the total stream network is comprised of headwaters – nearly double the total length represented in prior estimates. Stream density varied fivefold across regions, from under 1 km•km-² in arid basins to over 5 km•km-² in humid, forested areas. Over 73% of the CONUS landmass drains from headwater streams. The majority of headwater stream length occurred in forested and cultivated catchments across the CONUS, while substantial regional differences were evident for headwater stream distribution in other land cover classes (e.g., wetlands, urban areas, shrublands, and herbaceous-dominated catchments). Our analysis provides the first continental-scale, high-resolution characterization of headwater streams, offering new insights and opportunities for hydrologic modeling, ecological assessments, and environmental policy. Plain Language Summary: Headwater streams—the small streams at the origins of rivers—are essential for clean water and healthy ecosystems. But because they’re small and often hidden, they've been hard to identify and delineate nationwide due to inconsistent data and definitions. This study combined existing data sets and added new analyses to consistently map headwater streams and the drainages across the conterminous United States (CONUS). Analysis of these data revealed that headwater streams are nearly twice as widespread as previously shown, totaling 8.4 million kilometers. We also found that most land drains to a headwaters stream, and most stream kilometers are headwaters. Human alteration of the landscape for agriculture and urbanization also reduces the prevalence of headwater streams. This is the first time headwater streams have been identified on available maps with such granularity and spatially explicit detail across the CONUS, offering a powerful new tool to guide conservation and policy.
    1
    4 days ago
  • All data is available from the sources as cited in the journal references. This dataset is not publicly accessible because: Data is available through publicly accessible journal articles. It can be accessed through the following means: Data can be accessed through journal article references. Format: various formats. This dataset is associated with the following publication: Boddu, V.M., J. Morales, M.N. Nadagouda, L. Oudejans, and L. Brooks. Thermophysical treatment technologies for chemical warfare agents sulfur mustard, sarin, and nerve agent VX - A Review. Environmental Science: Advances. Royal Society of Chemistry, London, UK, 4(10): 1538-1552, (2025).
    0
    4 days ago
  • The dataset provides an excel file summary of the information used to generate Figures 2 and 4 in the journal article. The other figures in the paper are not based on datasets. The data used to generated Figures 2 and 4 combinates information found in Table 1 of the main text and Tables S3 and S5 in the Supporting Information. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • Dataset and data dictionary associated with the journal article titled “A High-resolution Satellite Survey of Methane Emissions from Sixty North American Municipal Solid Waste Landfills”, Krause M., Thoma, E.D. (corresponding author), Bryant, A., Brantley, H., MacDonald, M., Green, R., Thorneloe, S., ES&T, 2025, 59 (29), (Published July 7, 2025). ”, by Krause M., Thoma, E.D. (corresponding author), Bryant, A., Brantley, H., MacDonald, M., Green, R., Thorneloe, S., ES&T, 2025, 59 (29), (Published July 7, 2025). DOI: 10.1021/acs.est.5c01409. This dataset is associated with the following publication: Krause, M., E. Thoma, A. Bryant, H. Brantley, M. MacDonald, R. Green, and S. Thorneloe-Howard. A High-Resolution Satellite Survey of Methane Emissions from 60 North American Municipal Solid Waste Landfills. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 15080-15091, (2025).
    1
    4 days ago
  • NOAA hosted data archive for the 2017 Utah Winter Fine Particle Study. This dataset is associated with the following publication: Christie, J., H. Elliott, S.M.O. O’Connell-Lopez, K. Perry, K. Pratt, A.G. Hallar, A. Hrdina, J.G. Murphy, T. Riedel, R. Long, D. Mitroo, J.D. Haskins, and C.J. Gaston. Halogen Production from Playa Dust Emitted from the Great Salt Lake: Implications of the Shrinking Great Salt Lake on Regional Air Quality. ACS Earth and Space Chemistry. American Chemical Society, Washington, DC, USA, 9(3): 480–493, (2025).
    1
    4 days ago
  • Publicly available data used to generate manuscript figures. This dataset is associated with the following publication: Dietrich, M., M. Dumelle, A. Nahlik, H. Golden, J. Christensen, C. Lane, E. Moore, and G. Filippelli. Anthropogenic Metal Storage in Wetland Soils Across the Conterminous United States. WETLANDS. The Society of Wetland Scientists, McLean, VA, USA, 45: 64, (2025).
    1
    4 days ago
  • Drying has a major impact on pattern and process in streams, particularly in small or headwater streams. Such streams that dry recurrently are called non-perennial streams and represent most of the channel length across river networks. In spite of their prevalence, non-perennial streams are vastly underrepresented in existing stream gaging networks and in maps and hydrographic datasets. However, diverse and spatially extensive datasets of surface water presence observations exist as well as recently developed mobile applications that could help fill the data gap in characterizing the spatial extent of non-perennial streams. Hydrological data from perennial and non-perennial reaches were compiled from a series of studies on headwater streams to expand available data for mapping and modeling efforts in the United States. Hydrologic data within this compilation include visually recorded observations of hydrological status (dry, isolated pools, interstitial flow, and continuous surface flow), point measurements of discharge (cubic meters per second), and logger-based measurements for the timing and duration of streamflow and drying. These data were compiled across a series of studies on headwater streams (drainage area ~2.6 km2 or less) and were used to characterize their hydrology. Hydrologic data within this compilation are organized into files based on type of hydrologic data and study area. The types of hydrologic data include visually recorded observations of hydrological status (dry, isolated pools, interstitial flow, and continuous surface flow), point measurements of discharge (cubic meters per second), and logger-based measurements for the timing and duration of streamflow and drying. The study areas included in the compilation include headwater streams in Kentucky (Robinson Forest), Illinois (Shawnee National Forest), Indiana (Hoosier National Forest), New Hampshire (Dodge Brook), New York (Balsam Lake Mountain), North Dakota (Pipestem), Ohio (Congress Run, Edgewood Preserve, Edge of Appalachia, Wayne National Forest), South Carolina (Carolina Sandhills, Sugarloaf Mountain, Sumter National Forest Enoree and Long Cane Districts), Tennessee (Big Ridge), Vermont (Hinesburg), Washington (Mt. Baker-Snoqualmie), and West Virginia (Coopers Rock). A more detailed description of the data files are included within the Data description.docx and Data Dictionary for logger data compilation.xlsx files.
    1
    4 days ago
  • The data for Zhang et al. 2025 are publicly available online in the supplementary information associated with the article. See link provided. This dataset is associated with the following publication: Zhang, X., S.D. LeDuc, S. Kim, B.E. Dale, K. Zhao, Y. Zhou, G.W. McCarty, and G.E. Moglen. Soil erosion and lateral carbon fluxes from corn stover-derived biofuel. Scientific Reports. Nature Publishing Group, London, UK, 15(1): 18315, (2025).
    1
    4 days ago
  • Links provide access to the following input datasets: - Current range data/shapefiles can be accessed using the IUCN Red List website. Search the species of interest to download the available data. - Species observation data from iNaturalist and GBIF. Search the species of interest to download the available data. - GTOPO30 elevation data from USGS. Use Entity ID GT30W100N40 and GT30W100N90 to access elevation data or the eastern US. - WorldClim baseline and future climate projections. - Conterminous United States Land Cover Projections for 1992 to 2100 from USGS. - 2023 Crop Frequency Layer for US from USDA. Identifies crop specific planting frequency using land cover information from 2008-2023. - Watershed Boundary Dataset (WBD) for US from USGS Metadata for each dataset is provided by each data source. This dataset is associated with the following publication: Reimer, J., J. Bousquin, and J. Awkerman. Amphibian species vulnerability to agricultural pressure resulting from changing climate suitability in the southeastern US. Integrated Environmental Assessment and Management. Allen Press, Inc., Lawrence, KS, USA, vjaf109, (2025).
    8
    4 days ago
  • This is the dataset used in Chuman et al., which is an assessment of the effect of nitrogen deposition on plant communities in the U.S. and Czech Republic, and how bedrock modifies that response. This dataset is not publicly accessible because: It is not EPA's data to share. It can be accessed through the following means: Contact Thomas Chuman for access to the data (tomas.chuman@email.cz). Format: It is a .csv file.
    0
    4 days ago
  • This dataset contains the title and abstract level and full text screening results of a systematic literature search for the disinfection byproduct bromodichloromethane up to June 2025. This dataset can be used to complete a systematic evidence map for this particular byproduct.
    2
    4 days ago
  • The AM EoL - Material Flow Analysis and GREENSCOPE_11-25-23_TradeOff.xlsx file contains the data supporting the GREENSCOPE sustainability assessment associated with the management of end-of-life (EoL) materials following additive manufacturing. This repository contains an Excel spreadsheet used to calculate material and energy flows of additive manufacturing products during their end-of-life stage. GREENSCOPE Calculation Tab supplies the data and calculations to obtain the energy, economics, material efficiency, and environmental sustainability indicators; parameters and assumptions are listed in the “EoL Material Flow Analysis” Tab. All references leading to the necessary parameters and assumptions are listed in the “References” tab. Other Tabs like Energy Indicator, Economic Indicator, Efficiency Indicator, and Environmental Indicator Tabs show more granular steps to calculate each sustainability indicator. The Microsoft word information document titled “Chea_GS AM EoL Sustainability Analysis SupportingInfo grm_jdc.docx” contains a list of parameters and numerical assumptions made for the material flow analysis in the end-of-life stage following additive manufacturing; conceptual assumptions; material flow analysis results tracing the mass distribution of the additive manufacturing industry; and additional references. The file Figure 2 Data - Sustainability Assessment of AM EoL Material Management.docx contains the data used to make Figure 2. This dataset is associated with the following publication: Chea, J.D., G.J. Ruiz-Mercado, R.L. Smith, M.A. Gonzalez, and D.E. Meyer. Sustainability assessment of additive manufacturing end-of-life material management. Next Sustainability. Elsevier B.V., Amsterdam, NETHERLANDS, 5: 100085, (2025).
    3
    4 days ago
  • Biodegradation data under aerobic and anaerobic conditions for: Total Carbon TC Inorganic Carbon IC Dissolved Organinc Carbon DOC Total Suspended Solids TSS Volatile Suspended Solids VSS triethylene glycol monododecyl ether TGDE N,N-dimethyldodecylamine N-oxide DDAO diethylene glycol monobutyl ether DGBE ethylene glycol monododecyl ether EGDE ethylene glycol butyl ether EGBE N,N-dimethyltetradecylamine-N-oxide DTAO sodium lauryl sulfate SLS sodium n-tridecyl sulfate STS. This dataset is associated with the following publication: Penrose, M., M. Modiri, V. Gomez-Alvarez, H. Ryu, M.N. Nadagouda, and M. Ateia. Fluorine-free foams exhibit incomplete aerobic and anaerobic biodegradation, create redox-specific byproducts and shift microbial communities. Environmental Science: Processes & Impacts. Royal Society of Chemistry, Cambridge, UK, 27(9): 2809-2820, (2025).
    1
    4 days ago
  • Data are biological and chemical in nature. They describe organismal responses to copper treatments. The abstract can be found below. Copper can be toxic to aquatic organisms at high concentrations and has been previously used successfully to control zebra mussels (Dreissena polymorpha). Because copper’s toxicity changes with water chemistry, using the same copper concentration in different waterbodies could yield different outcomes. We demonstrate how measuring water chemistry parameters and using the Biotic Ligand Model (BLM) and multiple linear regression (MLR) models can predict a suitable, site-specific copper concentration for management. We exposed zebra mussel adults and non-target organisms to varying concentrations of copper over 10 d in a mobile laboratory. We found that one non-target species, Daphnia magna, had a 50% chance of survival at 9.50 µg Cu/L (i.e., the 50% lethal concentration, LC50), within our BLM-predicted range of 3.38–16.95 µg Cu/L LC50 values. In the future, managers could make similar predictions and tailor their copper concentrations to their management goals. We also measured zebra mussel larvae mortality at copper concentrations ranging from 0 to 191 µg Cu/L. While those results were inconclusive, we present the results of this work as a foundation for future projects. Our study underscores the importance of developing site-specific copper concentration recommendations and demonstrates the potential utility of the BLM and MLR approaches for informing those recommendations. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • This data set includes flow cytometry data for planktothrix in samples collected from Grand Lake St. Marys and downstream waterways in 2024.
    1
    4 days ago
  • This data set includes flow cytometry data for planktothrix in samples collected from Gran Lake St. Marys and downstream waterways in 2025
    1
    4 days ago
  • The data consists of sequence reads generated from an Illumina MiSeq. This dataset is associated with the following publication: Ruth, N., N. Brinkman, M. Jahne, P. Chain, S. Keely, and M. Shakya. DNA viruses from different stages of a wastewater treatment plant in southwest Ohio. Total Environment Microbiology. Elsevier B.V., Amsterdam, NETHERLANDS, 1(4): 100031, (2025).
    1
    4 days ago
  • THM analysis results for water samples taken from the raw water and water treatment plant during the 2018 flood event. The water samples were chlorinated at 1,3,5 mg/L free chlorine. This dataset is associated with the following publication: Yang, J., C. Buahin, and R. Murray. Modeling and assessing chlorinated and brominated THM formation for water treatment adaptation against hydroclimatic impacts. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 999: 180312, (2025).
    1
    4 days ago
  • Lead concentrations in drinking water samples collected under various sampling protocols in homes with lead service lines and in homes without lead service lines in two US cities. This dataset is associated with the following publication: Lytle, D., M. Urbanic, A. Paul, R. Achtemeier, A. Lewis, S. Hammaker, A. Estep, M. Nadagouda, R. James, and S. Triantafyllidou. Alternative approaches to lead sampling in drinking water: A comparative study of homes with and without lead service lines in two cities. WATER RESEARCH. Elsevier Science Ltd, New York, NY, USA, 994: 180063, (2025).
    1
    4 days ago
  • This paper presents data from studies performed to satisfy test orders from the US EPA’s Endocrine Disruptor Screening Program. Data Evaluation Records were used to collate the control variability and performance of biological endpoints in AMAs conducted in different laboratories, then supplemented with additional recent studies. We examine the statistical power of AMA endpoint analysis and assess whether historical control data (HCD) can assist evidence-based interpretation of the endpoints, with 52 studies from 7 different laboratories. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • This includes various EPA contract lab conducted studies using 2EHHB and referenced in a 2EHHB Review manuscript. Citation information for this dataset can be found in Data.gov's References section.
    9
    4 days ago
  • The Environmental Quality Index (EQI) accounts for the multiple domains of the environment with which humans interact. These domains include chemical, natural, built, and sociodemographic environments that have both positive and negative influences on health. An overall EQI was created for census tracts within the contiguous United States for 2006-2010 and 2011-2015. Provided data sets include full EQI for 2006-2010 and 20011-2015, variables used to create the census tract EQI, as well as links to maps of the data.
    1
    4 days ago
  • Urban environments often contain mosquito species that are responsible for transmitting medically important pathogens to humans. Large disturbance events, like hurricanes, can devastate large urban areas, especially in the tropics; however, little data exist for how these storms affect vector populations. During September 2017, Hurricanes Irma (category 5) and Maria (category 4) passed in proximity to the island of Puerto Rico, USA, causing significant damage to the built environment and significantly altering the abiotic environmen,t including the removal of the plant canopy. We measured adult Aedes aegypti populations, the main vector of several pathogens, and larval containers across eight neighborhoods in San Juan, the capitol, that varied in socioeconomic status (SES) across eight sampling periods over 17 months following the storms. We also analyzed the nutrient content (%N, %C, C:N) and stable isotopes (δ15N, δ13C) from adults and isotopes from containers to assess how the nutrient environments changed post hurricanes. Mosquito population sizes were invariant throughout sampling, although more females were collected in lower SES neighborhoods that were more enriched in δ15N compared to higher SES locations. We did find that the storms altered the stoichiometric content of adults, with lower C:N values right after compared to a year later; larval containers showed an increase in δ15N through time. The lack of any interactive effects of the storms on specific neighborhoods suggests that Irma and Maria affected all locations equally, however, the storms altered the nutrient content of both adults and larval containers, a result with implications for pathogen transmission. This dataset is associated with the following publication: Yee, D.A., N.A. Scavo, L.J. Reyes-Torres, and A. Oczkowski. How Hurricanes Irma and Maria affected population dynamics and nutrient content of Aedes aegypti in San Juan, PR, USA: socioeconomic and temporal factors. Journal of Urban Ecology. Oxford University Press, OXFORD, UK, 10(1): juae019, (2024).
    1
    4 days ago
  • A description of the dataset can be found at: https://aslopubs.onlinelibrary.wiley.com/doi/10.1002/lol2.10459. This dataset is associated with the following publication: Fulweiler, R.W., S. Rinehart, J. Taylor, M. Kelly, M. Berberich, N. Ray, A. Oczkowski, S. Balint, M. Benavides, M. Church, B. Loeks, S. Newell, M. Olofsson, J. Oppong, S. Roley, C. Vizza, S. Wilson, S. Chowdhury, P. Groffman, T. Scott, and A. Marcarelli. Global importance of nitrogen fixation across inland and coastal waters. SCIENCE. American Association for the Advancement of Science (AAAS), Washington, DC, USA, 388(6752): 1205-1209, (2025).
    1
    4 days ago
  • Concentration data describing PFAS in whale baleen samples. This dataset is not publicly accessible because: Not EPA data, data is owned by Stanford University. It can be accessed through the following means: Contact external author Matthew Savoca at msavoca13@gmail.com. Format: Final data is in Excel format. This dataset is associated with the following publication: Savoca, M.S., A.R. Robuck, M.A. Cashman, M.G. Cantwell, L.C. Agvent, D.N. Wiley, R. Rice, S. Todd, N.E. Hunter, J. Robbins, J.A. Goldbogen, and R. Lohmann. Whale Baleen To Monitor Per- and Polyfluoroalkyl Substances (PFAS) in Marine Environments. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 11(8): 862-870, (2024).
    0
    4 days ago
  • The GitHub site contains the code and data to run two methods as shown in the manuscript. The first quantifies external load, internal load, and source attributed impact on cyanoHAB severity. This method was written using R language (version 4.2.2). The second method maps potential legacy P stores in upstream watersheds of Lake Mendota, WI (USA) and estimates the total P load per contributing area across watersheds. This method was written using Python language (version 3.8.5) & GeoPandas (version 0.8.2). 1. Impact_model_method The impact model method is a series of sequential programs that take original source data, performs quality control checks and re-formats the data as new data files for input into the impact model. The Impact_model_method folder has all programs used in this method. All code is written in R Markdown format (.Rmd). Here's the order to run the R programs and achieve the same results as shown in the manuscript: cyanoHAB_severity.Rmd - calculates cyanoHAB severity (as Chl-a and cyanobacteria density) TotalP_external_atmdep.Rmd - calculates external total P loads from atmospheric deposition TotalP_external_inflows.Rmd - calculates external total P loads from inflows (streams) TotalP_external_all.Rmd - calculates the sum of external total P loads (streams + atmospheric deposition) EpiVolume.Rmd - calculates the change in volume of the epilimnion using temperature profiles TotalP_water.Rmd - calculates the total P concentration in the epilimnion, total P concentration in the hypolimnion, and ratio of total P in hypolimnion to epilimnion (as alternative indicator of internal P load) TotalP_internal.Rmd - calculates internal total P loads (or alternatively the ratio of totalP_hypo:totalP_epi) Model_inputs.Rmd - prepares the data as input for impact modeling (defines predictor and response variables) Impact_model.Rmd - performs the statistical modeling for impact analysis on cyanoHAB severity by source (external vs internal) and outputs the partitioned sum of squares for each predictor term 2. Spatial_model_method The spatial model method takes original source data, performs quality control checks and re-formats the data as new data files for input into the spatial model. The model maps potential legacy P stores in upstream sub-watersheds, and quantify total P load per contributing area across sub-watersheds. All programs used in this method are provided in the Spatial_model_method folder. All code is written in Python language (.py or .ipynb). The specific order in which programs should be run to achieve the same results as shown in the manuscript is as follows: HydroGraph_functios.py - performs the network mapping of sub-watersheds upstream of the inflows to the lake watershed_analysis.ipynb - calculates the P export per contributing area for each of the upstream sub-watersheds OHSA.py - performs the optimized hot spot analysis for determining statistically clustered stream monitoring sites with consistently high P concentrations. This dataset is associated with the following publication: Knose, L.A., D.L. Cole, E. Martin-Hernandez, V.M. Zavala, M.A. Gonzalez, C. Vaneeckhaute, and G.J. Ruiz-Mercado. The Impact of Legacy Nutrient Loading from Lake Sediments on Cyanobacteria Bloom Severity. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 5(9): 4997-5010, (2025).
    1
    4 days ago
  • Chemical ionization mass spectrometry data from thermal treatment of PFOA in EPA's pilot scale Rainbow furnace. Definitions of variables included in dataset. This dataset is associated with the following publication: Rocchio, C., J. Mattila, S. Sharma, J. Krug, G. Kogekar, W. Roberson, J. Offenberg, K. Pennell, W. Linak, and C.F. Goldsmith. Incineration of Perfluorooctanoic Acid Leads to Regeneration of Smaller Perfluorocarboxylic Acids. JOURNAL OF PHYSICAL CHEMISTRY A. American Chemical Society, Washington, DC, USA, 129(35): 8160–8169, (2025).
    1
    4 days ago
  • Data from manuscript Episodic Exposure to Eucalyptus Smoke during Sperm Maturation Impairs Sperm Motility in Long Evans Rats. This dataset is associated with the following publication: Klinefelter, G., J. Dye, L. Strader, H. Nguyen, M. Schladweiler, G. Palmer, M. Moore, P. Evansky, M. Higuchi, M. Monsees, I. George, M. Hays, J. Martin, N. Warren, W. Williams, B. Yoo, R. Grindstaff, W. Padgett, I. Gilmour, and C. Miller. Episodic exposure to eucalyptus smoke during sperm maturation impairs sperm motility in Long Evans rats.. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(28): 14314–14323, (2025).
    1
    4 days ago
  • Clean Water Act (CWA) coverage extends to certain wetlands, including those with a continuous surface connection to relatively permanent tributaries. However, limited information is available to estimate the national extent of wetlands potentially afforded CWA coverage. To address this data gap, we identified conterminous US (CONUS) palustrine wetlands connected by an exploratory 150-m buffer to a high-resolution CONUS-wide stream network hydrography dataset, a reasonable and defensible proxy for a continuous surface connection between wetlands and relatively permanent waters. Nationally, 79% (23.1 Mha) or 66% (19.3 Mha) of the nation's CONUS freshwater palustrine wetlands are potentially connected to the stream network, depending on whether a more inclusive or exclusive flow permanence network is analyzed. Conversely, 21% (6.1 Mha, roughly the area of West Virginia) or 34% (9.9 Mha, greater area than Indiana) of CONUS wetlands may be outside this buffer. Results for individual states varied widely based on stream and wetland density. States with a low relatively permanent stream density had fewer buffer-connected wetland resources (e.g., 21% in North Dakota). Similarly, wetlands in southwestern states and other states with abundant ephemerally flowing streams were also not connected via the applied buffer. Geospatial data limitations and assumptions (e.g., omission errors, presumed presence of a surface connection) suggest the estimated extent of wetlands with potential continuous surface connections to federally covered waters are likely to be substantially smaller than reported here. Nonetheless, the analyses herein provide insights for local, state, and tribal stakeholders to consider in managing their wetland resources. This dataset is associated with the following publication: Lane, C., E. D'Amico, J. Christensen, K. Fritz, and H. Golden. Linking wetlands to relatively permanent flowing waters: a conterminous United States geospatial analysis. Wetlands Ecology and Management. Springer Science and Business Media B.V;Formerly Kluwer Academic Publishers B.V., GERMANY, 33: 30, (2025).
    1
    4 days ago
  • Analog/Digital points for individual animal's average brainstem auditory evoked responses (BAERs) and a second file with the scored peak latencies and amplitudes from the BAERs.
    1
    4 days ago
  • This dataset contains the Appendices to EPA report EPA/600/R-25/172, "PFAS Destruction by a Hazardous Waste Incinerator: Testing Results." The report summarizes the results from testing for per- and polyfluoroalkyl substances (PFAS) in the emissions from a hazardous waste incinerator. The appendices include data tables and analytical laboratory reports from the methods employed during the test, Other Test Method (OTM) - 45, OTM-50, Method 0010/3542/8270, Method 1633, and ASTM method D6348. Also included are the reports from the stack testers, data validator, spiking crews, and other information to support the report. This dataset is associated with the following publication: Troxler, W., W. Anderson, C. McBride, J. Whitehead, M. Klingerman, J. Kumm, P. Challa Sasi, S. Yankay, M. Modiri, S. Corum, C. Adkins, E. Redman, C. Laush, S. Hall, A. Jensen, S. Waters, D. Spangler, S. Neal, T. Bales, M. Mills, P. Potter, E. Shields, W. Roberson, and S. Jackson. PFAS Destruction by a Hazardous Waste Incinerator: Testing Results. U.S. EPA Office of Research and Development, Washington, DC, USA, 2025.
    14
    4 days ago
  • Water Quality Data for Separate and Combined Sewer Systems, including: Biochemical Oxygen Demand (mg/L) Tot. Suspended Solids (mg/L) Cyanide (mg/L) Cyanide Free (Low Level) (ug/L) Cyanide Amenable (mg/L) Antimony (mg/L) Arsenic (mg/L) Beryllium (mg/L) Cadmium (mg/L) Calcium (mg/L) Chromium (mg/L) Cobalt (mg/L) Copper (mg/L) Iron (mg/L) Lead (mg/L) Magnesium (mg/L) Molybdenum (mg/L) Nickel (mg/L) Selenium (mg/L) Silver (mg/L) Strontium (mg/L) Thallium (mg/L) Tin (mg/L) Titanium (mg/L) Vanadium (mg/L) Zinc (mg/L) Nitrite as N (mg/L) Ammonia as N (mg/L) Nitrate + Nitrite (mg/L) Total Kjeldahl Nitrogen (mg/L) Total Phosphorus (mg/L) COD (mg/L) Nitrate as N Calc (mg/L). This dataset is associated with the following publication: Butzlaff, A.H., J. Deighton, T. Le, A. Brougham, S.M. Bessler, T. McKnight, and M. Ateia. PFAS, 6-PPD-Q, and microplastics in urban sewer overflows: co-occurrence and high-rate treatment assessment .. NATURE. Nature Portfolio, Berlin, GERMANY, 1: 5, (2025).
    1
    4 days ago
  • The zip files contain Python scripts and SQLite databases needed to replicate the modeling, analysis, and accuracy assessment discussed in the manuscript. R scripts are also included, which can be used to replicate the spatial interaction model (i.e., zero-inflated regression). This dataset is associated with the following publication: Morefield, P.E., and T.F. Leslie. County-to-county migration modeling in the United States: the effects of data source and model selection. Journal of Geographical Systems. Springer, Heidelberg, GERMANY, 27(3): 455-472, (2025).
    4
    4 days ago
  • The dataset include the report of the groundwater analysis in Shepley's Hill Landfill, and a report of clustering of the groundwater samples based on their chemical composition. This dataset is associated with the following publication: Li, T. Speciation of Aqueous Iron and Arsenic for Assessing Mechanisms of Arsenic Attenuation in Groundwater. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 5(9): 5523-5530, (2025).
    2
    4 days ago
  • This dataset provides information on how photochemical aging alters the chemical compositions of the smoke depending on burning conditions and increases oxygenated VOC emissions but degrades particle-bound PAHs. Also the findings indicate that PAH degradation is more pronounced in flaming than smoldering smoke particles, suggesting that PAH-induced toxicity of the smoke particles varies depending on photochemical aging and burning conditions. This dataset is associated with the following publication: Kim, Y.H., A. Sinha, I. George, D. DeMarini, A. Grieshop, and M. Gilmour. Toxicity of fresh and aged anthropogenic smoke particles emitted from different burning conditions. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 892: 164778, (2023).
    1
    4 days ago
  • This study sought to examine whether mild preexisting allergic airways disease enhances the response of the lungs to burn pit smoke emissions. The findings indicate that exposure to house dust mite (HDM) antigen sensitizes the mouse lungs to make them more susceptible to burn pit smoke-induced dysfunction, in both the inflammatory response to burn pit smoke and in the accumulation of airway mucus. This suggests that changes in cilia and mucociliary clearance (MCC) induced by asthma that are amplified by inhalation of burn pit smoke, followed by a feedback loop of enhanced inflammation induced by the accumulating mucus, appears a likely mechanism. This dataset is associated with the following publication: Belfield-Simpson, L., J. Martin, M.K. McPeek, A. Livraghi-Butrico, H. Dang, Y.H. Kim, I. Gilmour, and C. Doerschuk. Combustion products of burn pit constituents induce more changes in asthmatic than non-asthmatic murine lungs. Particle and Fibre Toxicology. BioMed Central Ltd, London, UK, 22: 21, (2025).
    1
    4 days ago
  • This is the data presented in https://pubs.acs.org/doi/10.1021/acs.chemrestox.5c00236, Identification of Anatoxin-a and Related Metabolites in Exposed Mice Samples with a High-Resolution Mass Spectrometry Discovery Workflow
    1
    4 days ago
  • The toxicity of liver and kidney upon acute and subacute exposure to bromochloromethane in both male and female rats. This dataset is associated with the following publication: Simmons, J., T. Willoughby, M. Armstrong, M. Donohue, A. McDonald, and Y. Sey. EVALUATION OF HEPATIC AND RENAL EFFECTS OF ACUTE AND SUBACUTE ORAL EXPOSURE TO BROMOCHLOROMETHANE IN RATS. TOXICOLOGY AND APPLIED PHARMACOLOGY. Elsevier B.V., Amsterdam, NETHERLANDS, 504: 117509, (2025).
    1
    4 days ago
  • Three PurpleAir sensors were collocated with a T640x reference monitor at the Durango Complex Air Quality Monitoring Station in Phoenix, Arizona in May 2019. Both instruments measured PM2.5 and PM10 and this collocation exercise was done to better understand how the sensor data compared to the reference data and what data cleaning and correcting would need to be applied to the sensor data to make these two dataset more comparable. These data files contain the raw data from this experiment at 1 minute and 20 second time resolution for the sensor data and 1 hour time resolution for the reference monitor data. Data provided courtesy of USEPA and our project partners Maricopa County Air Quality Department. This dataset is associated with the following publication: Kumar, M., S. Frederick, K. Barkjohn, and A. Clements. Sensortoolkit—A Python Library for Standardizing the Ingestion, Analysis, and Reporting of Air Sensor Data for Performance Evaluation. Sensors. MDPI, Basel, SWITZERLAND, 25(18): 5645, (2025).
    8
    4 days ago
  • The data include a data dictionary (read first), a test log, a spreadsheet containing the UVC intensity measurements (along with temperature and relative humidity), and the microbiological data (the bacterial spore recovery) for each test. This dataset is associated with the following publication: Wood, J., M. Monge, E. Seto, K. Ratliff, B. Ford, D. Aslett, A. Abdel-Hady, and L. Mendez Sandoval. Sterilization of stainless-steel surfaces using ultraviolet radiation produced by light emitting diodes. Astrobiology. Mary Ann Liebert, Inc., New Rochelle, NY, USA, 25(8): 550-562, (2025).
    32
    4 days ago
  • This data set includes qPCR data for the microcystin producing planktothrix (mcyApla) gene and the microcystin producing cyanobacteria (Hep) gene for samples collected from Grand Lake St. Marys and downstream waterways in 2025.
    1
    4 days ago
  • Dataset for 'A high throughput screening assay for human Thyroperoxidase inhibitors' by Hongyan Dong, et al., a collaboration work with primary authorship at Health Canada. Published in Toxicology in Vitro, Vol 101, 105946, Dec 2024; DOI https://doi.org/10.1016/j.tiv.2024.105946. Supplementary Data File 1: Examples of two solution plates and the resulting assay plate layouts for Single concentration phase. Supplementary Data File 2: The tcpl analyses of all multiple concentration phase data including plots of fitted models, estimates of log AC50 (ga), and hit call. Supplementary Data File 3: Supplementary Tables 1-5. For further data, please contact corresponding author Hongyan Dong at email Hongyan.Dong@hc-sc.gc.ca. This dataset is associated with the following publication: Dong, H., K. Friedman, A. Filiatreault, E. Thomson, and M. Wade. A high throughput screening assay for human Thyroperoxidase inhibitors. TOXICOLOGY IN VITRO. Elsevier Science Ltd, New York, NY, USA, 101: 105946, (2024).
    3
    4 days ago
  • The exposome represents the totality of chemicals present in an organism’s tissues. To understand how external exposure, originating from the contamination of water and sediment, relates to the internal exposure of fathead minnow (Pimephales promelas, FHM), a model small fish species, we conducted a 21-d caging study at four field sites in the Great Lakes with different pollution loads and patterns. We determined the FHM’s body burden, total water concentrations and freely dissolved concentrations in sediment pore water of 456 organic micropollutants. Up to 123 micropollutants were detected in water, 165 in sediment and 153 in FHM. Chemical concentrations at the different study sites varied largely, with one site impacted by a municipal wastewater treatment plant having the highest overall concentrations, with a prevalence of personal care and household products, pharmaceuticals and pesticides. The other sites, associated with past industrial inputs, were characterized by elevated concentrations of legacy contaminants, including polycyclic aromatic hydrocarbons. We observed a moderate agreement of contamination patterns in fish compared to chemicals found in the sediment, while the water phase was dominated by more hydrophilic chemicals often not present in the fish. The study shows the degree of predictability of the exposome in fish that may be expected based on chemical concentrations in water and sediment based on equilibrium partitioning and provides evidence for the need of body burden analysis to comprehensively understand an organism’s exposure to environmental contaminants. This dataset is not publicly accessible because: The data is not EPA-generated. It can be accessed through the following means: Data will be made publicly available upon publication. Format: The data are in an Excel spreadsheet and included the following parameters: S1: Site description S2: Substances S2a: target substances and additional information S2b: list of used internal standards S2c: substances and additional information S3: Water data S3a: measured concentrations of the different time points and the site averages plus standard-deviations S3b: average plus standard-deviations of concentrations at the different time point S4: Sediment data S4a: sediment wet weights S4b: sediment dry weights S4c: total organic carbon (TOC) of the sediment S4d: concentration in sediment from all sites; application of stability factor S4e: reduced dataset of the concentrations with average values and standard deviation S5: Fathead Minnow data S5a: wet weights S5b: wet weight normalized concentrations (ng/gww) for each clean-up method S5c: aggregated dataset using the concentrations of the method with better recovery S5d: MAX values of cFHM at each site S5d: lipid content of FHM samples S5e: FHM concentrations normalized to lipid content (see S5d); PSA and C18 combined depending on recoveries and MDLs S5f: MAX values of c_FHM (ww) at each site S6: Fish food data S6a: wet weight and lipid content of brine shrimp and trout chow S6b: wet weight-normalized concentrations S7: Literature data for KOC data from Niu et al. and EPISuite S8: Data used for venn diagram and violin plot S9: Data used for systematic comparison of occurrences in FHM, water, and sediment S9a: Number of pattern-detects (A, E); systematic comparison of the occurrence of target substances S9b: Detected compound classes S9c: Number of overlaps S9d: Agreement occurrence in FHM S9e: Number of pattern-detects S10: Calculated BCF and BSAF S11: Values of the predicted (expected) concentrations in FHM derived from the concentrations in water, sediment, and the predicted BCF and BSAF values. This dataset is associated with the following publication: Dann, J., G. Ankley, B. Blackwell, B. Escher, A. Jahnke, K. Jensen, C. Jenson, M. Krauss, S. Scholz, T. Wernicke, and W. Brack. Current emission vs. legacy organic pollutants: Assessing the extent to which the eco-exposome of caged fish reflects external exposure. ENVIRONMENTAL POLLUTION. Elsevier Science Ltd, New York, NY, USA, 383: 126808, (2025).
    0
    4 days ago
  • The datasets are the water temperature data for the MRB. Mainly for the main outlets for sub-basins. Include historical and future data. This dataset is associated with the following publication: Tang, C., and V. Garcia. Identifying stream temperature variation by coupling meteorological, hydrological, and water temperature models. JOURNAL OF THE AMERICAN WATER RESOURCES ASSOCIATION. American Water Resources Association, Middleburg, VA, USA, 59(4): 665-680, (2023).
    1
    4 days ago
  • Dataset for Jurgelewicz, A. et al, 'Assessing the impact of in vitro xenobiotic metabolism on estrogenic chemical bioactivity in high-throughput profiling assays' published in Toxicology, Vol 517, 154215, Nov 2025 DOI: 10.1016/j.tox.2025.154215. This dataset is associated with the following publication: Jurgelewicz, A., K. Breaux, C. Willis, F. Harris, G. Byrd, J. Witten, D. Haggard, C. Deisenroth, and J. Harrill. Assessing the impact of in vitro xenobiotic metabolism on estrogenic chemical bioactivity in high-throughput profiling assays. TOXICOLOGY. Elsevier Science Ltd, New York, NY, USA, 517: 154215, (2025).
    2
    4 days ago
  • Fish biometric data and fish tissue data (total PCB concentration, lipid content, carbon and nitrogen stable isotope ratios) associated with the study "Incorporating habitat use and life history to predict PCBs residues in fish" by Hoffman et al. Sediment data (total PCB concentration, carbon content) can be found in the NOAA DIVER data portal and the link is included. This dataset is associated with the following publication: Hoffman, J., T. Hollenhorst, G. Peterson, J. Launspach, E. Coffman, and L. Burkhard. Incorporating habitat use and life history to predict PCB residues in wild fish in an urban estuary. MARINE POLLUTION BULLETIN. Elsevier Science Ltd, New York, NY, USA, 209: 117271, (2024).
    2
    4 days ago
  • Dataset for "Cross-species comparisons of plasma binding and considerations for data evaluation.". This dataset is associated with the following publication: Lynn, S., I. Schultz, S. Matten, P. Patel, S. Watson, Y. Lan Yueh, S. Black, and B. Wetmore. Cross-species comparisons of plasma binding and considerations for data evaluation. TOXICOLOGY IN VITRO. Elsevier Science Ltd, New York, NY, USA, 106: 106036, (2025).
    1
    4 days ago
  • Per- and polyfluoroalkyl substances (PFAS) are chemicals of emerging concern that potentially pose risks to human and environmental health. In May–Oct 2018, sediment and passively collected surface water samples were collected from 62 tributary sites of the Laurentian Great Lakes with site catchments spanning gradients in land cover. Discrete samples of sediment and time-integrated surface water samples collected with polar organic chemical integrative samplers (POCIS) were analyzed for 23 and 34 PFAS, respectively. Concentrations of individual PFAS in sediment and surface water varied substantially among sites from below detection to 20,800 ng kg-1 and 247 ng L-1, respectively. Elevated PFAS concentrations occurred in urban watersheds and downstream of airports and wastewater treatment plants (WWTP). Of all target compounds, PFOS was the most frequently detected in sediment (56 of 62 sites) and had the highest median concentration (132 ng kg-1). PFOA, PFHxS, PFOS, PFHpA, and PFNA were detected in all 60 surface water sites, with median concentrations of 5.9, 5.2, 4.6, 3.7, and 1.3 ng L-1, respectively. Compounds with 8–14 fluorocarbons comprised a larger proportion of sediment PFAS than compounds with 4–7 fluorocarbons, whereas compounds with 4–7 fluorocarbons were dominant in surface waters. Watershed attributes, including urban land cover and WWTP flow fraction were positively related with PFAS sum concentrations in sediment and surface water. Collectively, these results highlight the relation PFAS occurrence has with human activities and documents widespread low-level PFAS contamination across the Great Lakes basin. This dataset is associated with the following publication: Loken LC, Corsi SR, Alvarez DA, Pronschinske MA, Lenaker PL, Nott M, Zhang C, Mani E, Ankley GT. Per- and polyfluoroalkyl substances (PFAS) in surface water and sediment in Great Lakes tributaries and relations with watershed attributes. In Review. This dataset is not publicly accessible because: It is inconsistent with established Federal practices for EPA to be the repository of data generated by the USGS. It can be accessed through the following means: All data will be completely accessible through the USGS and detailed instructions for its access will be described in the peer-reviewed journal article. Format: The data were generated by the US Geological Survey (USGS) who, like EPA, are required to make all their data publicly available through their open access website concurrent with publication of a paper. When this occurs, the data will be in a standard format, e.g., as spreadsheets with accompanying metadata. This dataset is associated with the following publication: Loken, L., S. Corsi, D. Alvarez, M. Pronschinske, P. Lenaker, M. Nott, C. Zhang, E. Mani, and G. Ankley. Per- and polyfluoroalkyl substances in surface water and sediment in Great Lakes tributaries and relations with watershed attributes. ENVIRONMENTAL TOXICOLOGY AND CHEMISTRY. Society of Environmental Toxicology and Chemistry, Pensacola, FL, USA, 44(6): 1503-1524, (2025).
    0
    4 days ago
  • This data set includes qPCR data for the microcystin producing planktothrix (mcyApla) gene and the microcystin producing cyanobacteria (Hep) gene for samples collected from Grand Lake St. Marys and downstream waterways in 2024.
    1
    4 days ago
  • This dataset includes volumetric water content data from 8 or 14 sensors in two bioretention planters and the relevant previous storm size. This dataset is associated with the following publication: Nissen, K., M. Borst, and E. Fassman-Beck. Influence of Volumetric Water Content Sensor Configuration in Evaluating Bioretention Planter Retention and Evapotranspiration. Journal of Hydrologic Engineering. American Society of Civil Engineers (ASCE), Reston, VA, USA, 30(5): 04025032, (2025).
    1
    4 days ago
  • FTIR Data. This dataset is associated with the following publication: Stavinskia, N., R. Sun, A.A. Dolatabad, M. Ateia, F. Xiao, and L. Velarde. Unraveling Hidden Infrared Spectral Signatures in PFAS Thermal Degradation with Two-Dimensional Correlation Spectroscopy. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 12(5): 668-676, (2025).
    1
    4 days ago
  • This ScienceHub entry contains a zip file with the pharmacokinetic modeling code used for the linked publication, "Challenges for extrapolation of risk from ingestion to inhalation exposure for per- and polyfluorinated alkyl acids and their precursors." The model code is written in R with a .model file written in the MCSim language. The inhalation pharmacokinetic model builds on a previous publication of Bernstein et al., "A Model Template Approach for Rapid Evaluation and Application of Physiologically Based Pharmacokinetic Models for Use in Human Health Risk Assessments: A Case Study on Per- and Polyfluoroalkyl Substances" https://doi.org/10.1093/toxsci/kfab063
    1
    4 days ago
  • This data set includes qPCR data for the microcystin producing planktothrix (mcyApla) gene and the microcystin producing cyanobacteria (Hep) gene for samples collected from Grand Lake St. Marys and downstream waterways in 2022.
    1
    4 days ago
  • The data files consist of measurements gathered from EPA's Meteorological Wind Tunnel Laboratory and Large Eddy Simulations (LES). Comparisons are made to the existing formulations in AERMOD, the EPA’s preferred Gaussian dispersion model. A data dictionary for each figure is provided in the zipped file package. This dataset is associated with the following publication: Retter, J., D. Heist, M. Pirhalla, C. Owen, W. Tang, T. Odom, and L. Brouwer. Including Dispersive Shear Stress in Urban Environments for Single Column Dispersion Models. BOUNDARY-LAYER METEOROLOGY. Springer, New York, NY, USA, 191(9): 39, (2025).
    1
    4 days ago
  • This is the greenhouse data for Clark et al. "Environmental sustainability of future fertilizers: Tradeoffs between ammonia volatilization and nitrate leaching for 11 enhanced efficiency fertilizers." The data quantifies the environmental performance (NH3 volatilization, N leaching) and agronomic performance (yield) for 11 enhanced efficiency fertilizers on two soil types (Minnesota sandy loam, Iowa clay loam). Yield results are published separately (Dolda et al. in review) but are included here for completeness. See Table S1 in the publication to cross reference brand names with active ingredients.
    1
    4 days ago
  • This EnviroAtlas dataset measures accessibility (i.e., proximity or nearness) of public outdoor recreational areas within an 800 meter walk (approximately 1/2 mile or 10-minute walk) along walkable routes and availability as the area of outdoor recreational space provided per person who can access it. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze many datasets related to ecosystem services. The dataset is available as downloadable data or as an EnviroAtlas map service. Additional descriptive information about each attribute in this dataset can be found in its associated EnviroAtlas Fact Sheet (https://www.epa.gov/enviroatlas/enviroatlas-fact-sheets) or journal article (https://doi.org/10.1016/j.landurbplan.2025.105445). This dataset is associated with the following publication: Killea, A., Baynes, J., Ebert, D., & Neale, A. (2025). Measuring access to and availability of outdoor recreational opportunities: One pixel at a time. Landscape and Urban Planning, 263, 105445. This dataset is associated with the following publication: Killea, A., J. Baynes, D. Ebert, and A. Neale. Measuring access to and availability of outdoor recreational opportunities: One pixel at a time. LANDSCAPE AND URBAN PLANNING. Elsevier Science Ltd, New York, NY, USA, 263: 105445, (2025).
    4
    4 days ago
  • This is the data for Heat, Humidity, and Adverse Birth Outcomes: Quantification of Projected Risks in the Contiguous United States Research increasingly demonstrates relationships between higher apparent temperatures, inclusive of heat and humidity, and greater rates of preterm birth (PTB), term low birth weight (tLBW), and stillbirth cases. Through leveraging available epidemiological studies, we estimated the change in burden of these outcomes across the contiguous United States (CONUS) and throughout the 21st century during warm season months (i.e., May through September or October). We projected an additional 4,500 PTBs, 3,800 tLBWs, and 420 stillbirths at 1°C of CONUS warming attributable to changes in apparent temperature relative to baseline climatic conditions (1985-2006). These cases increased to 22,000 PTBs, 18,000 tLBWs, and 2,000 stillbirths with 4°C of warming relative to the baseline. We projected the most significant changes in per capita rates to occur in Gulf Coast states, where baseline risks currently are among the highest in the CONUS. Across the three outcomes, we projected an increase in short-term healthcare costs following birth of approximately US$690 million annually at 1°C of warming, increasing to US$3.3 billion annually at 4°C (2023 dollars). When considering the economic burden of the infant deaths resulting from PTB and tLBW cases, we projected additional costs on the order of US$3.9 billion annually at 1°C, and US$35.8 billion annually at 4°C. Due to data availability, our valuation could not account for potential longer-term health and productivity implications or pain and suffering that families may experience following the adverse birth outcomes analyzed. This dataset is not publicly accessible because: Data will be updated upon acceptance by a journal. It can be accessed through the following means: Data will be provided at a later date. Format: Data will be updated upon acceptance by a journal
    0
    4 days ago
  • An innovative and sustainable immobilization remediation strategy concept for managing per- and polyfluoroalkyl (PFAS)-impacted soils was investigated at bench-scale. This approach involved the use of protein-based materials that are often considered waste products to serve as chemical (stabilization) sorbents, followed by cement binder (solidification), to explore their potential as a solidification/stabilization (immobilization) remediation process. The results of this immobilization study indicated that GAC, as a chemical stabilization agent, effectively reduced the leachability of PFAS compounds from an impacted soil. Minimal additional reduction in leachability was observed upon cement addition (solidification). While the blood meal sorbent was less effective than GAC as a stabilization agent, it did decrease leachability for the majority of the detected PFAS compounds in the soil. However, some of the PFAS compounds exhibited increased leachability post-treatment. Addition of cement as a solidification agent generally decreased the leachability for most of the detected PFAS compounds. Overall, this study suggests that protein-based sorbents, specifically blood meal, with solidification by cement addition may be a novel and sustainable remediation approach for certain PFAS-impacted soils, warranting further investigation into optimization strategies and potential field-scale applications. This dataset is associated with the following publication: McKernan, J.L., E. Barth, K. Dasu, D. Cutt, S. Hartzell, J. Lilly, K.R. Sims, D. Siriwardena, and E.M. Kaltenberg. Investigation of a novel protein-based immobilization process for PFAS contaminated soils. Total Environment Engineering. Elsevier B.V., Amsterdam, NETHERLANDS, 4: 100031, (2025).
    5
    4 days ago
  • This data set includes qPCR data for the microcystin producing planktothrix (mcyApla) gene and the microcystin producing cyanobacteria (Hep) gene for samples collected from Grand Lake St. Marys and downstream waterways in 2023.
    1
    4 days ago
  • This is the underlying data used to generate the willingness-to-pay estimates for salmon recovery in the publication "Valuing Wild Salmon and Steelhead Recovery in Oregon’s Most Urbanized Watershed.". This dataset is associated with the following publication: Papenfus, M., and M. Weber. Valuing Wild Salmon and Steelhead Recovery in Oregon's Most Urbanized Watershed. ECOLOGICAL ECONOMICS. Elsevier Science Ltd, New York, NY, USA, 236: 108540, (2025).
    1
    4 days ago
  • The U.S. Coral Reef Task Force (USCRTF) coordinates on-the-ground coral reef protection work, including helping coral reef jurisdictions manage the impacts of water quality on coral reef ecosystems. Water quality stressors such as nutrients, sediments, temperature, dissolved oxygen, metals, and others are known to have deleterious effects on a variety of individual and population scale coral reef endpoints. This dataset was developed by the EPA Office of Research and Development, in partnership with the USCRTF, to comprehensively synthesize the current body of information relating water quality measurements to coral reef ecosystem condition.
    1
    4 days ago
  • Associated R scripts that create manuscript and supplementary figures, as well as the data tables that correspond to the research publication. This dataset is associated with the following publication: O'Lenick, C., S. Cleland, L. Neas, M. Turner, E. Mcinroe, K. Hill, A. Ghio, M. Rebuli, i. Jaspers, and A. Rappold. Impact of Heat on Respiratory Hospitalizations among Older Adults in 120 Large US Urban Areas. Annals of the American Thoracic Society. American Thoracic Society, New York, NY, USA, 22(3): 367-377, (2025).
    1
    4 days ago
  • Data accompanies manuscript. Title: Impact of heat on respiratory hospitalizations among older adults living in 120 large US urban areas. This dataset is associated with the following publication: O'Lenick, C., S. Cleland, L. Neas, M. Turner, E. Mcinroe, K. Hill, A. Ghio, M. Rebuli, i. Jaspers, and A. Rappold. Impact of Heat on Respiratory Hospitalizations among Older Adults in 120 Large US Urban Areas. Annals of the American Thoracic Society. American Thoracic Society, New York, NY, USA, 22(3): 367-377, (2025).
    1
    4 days ago
  • The Community Multiscale Air Quality (CMAQ) model version 5.4 (epa.gov/cmaq) was applied with 12 km sized grid cells for a domain covering the conterminous U.S. and areas offshore. The vertical atmosphere was resolved up to 50 mb with 35 layers. Vertical layers were thinner nearest the surface to best resolve diurnal fluctuation in the surface mixing layers. Lateral boundary inflow was extracted from a hemispheric scale simulation for the same year. Meteorological inputs were developed with the Weather Research and Forecasting model version 3.8.1 applied with the same grid domain as the photochemical model. The Pattern Constructed Air Pollution Surfaces (PCAPS) model has been applied for complex sector-specific emissions scenarios for stationary and mobile sources and predicted air quality results consistent with more sophisticated models. PCAPS version 1.1 was applied for each year between 2024 and 2031 with year-specific offshore wind project and EGU emissions. PCAPS was also applied using the same offshore wind and onshore EGU emissions for the 2026 and 2055 scenarios simulated with CMAQ to allow for a direct comparison of results. This dataset is associated with the following publication: Baker, K., R.B. Rice, and N. Fann. Characterizing Air Quality Impacts Related to North Atlantic Offshore Emissions Sources. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 2(7): 1369-1378, (2025).
    2
    4 days ago
  • The entire year of 2016 is modeled with CMAQ version 5.2.1 (doi:10.5281/zenodo.1212601). The chosen simulation is evaluated extensively for air quality and meteorology performance. CMAQ is applied for a domain covering the CONUS using 12 km sized horizontal grid cells. The vertical atmosphere is resolved with 35 layers extending from the surface to the tropopause with finer resolution in the planetary boundary layer to better capture diurnal variation in mixing height. The Carbon Bond 6 revision 3 gas phase chemical mechanism, ISORROPIA II inorganic aerosol thermodynamics, aqueous phase cloud chemistry, and wet and dry depositional processes are included in the simulation. Primary organic aerosol is treated as non-volatile. SOA formation is described by semi-volatile partitioning of lumped gas-phase groups that include benzene, toluene, xylenes, naphthalene, monoterpenes, isoprene, and sesquiterpenes and particle-phase oligomerization. AqSOA is formed from glyoxal, glyoxal analogues (methylglyoxal and glycolaldehyde), and isoprene epoxydiols. Biogenic emissions are estimated using the Biogenic Emission Inventory System (BEIS) version 3.6.1 Anthropogenic emissions are based on the 2016 emissions modeling platform developed by the U.S. EPA. Lateral boundary inflow is extracted from a coarser scale model simulation that covered the northern hemisphere. Meteorological inputs from the Weather Research and Forecasting (WRF) model version 3.8 are used to develop biogenic emissions and drive atmospheric dynamics using the same domain and projection specifications as the CMAQ model simulation. This dataset is not publicly accessible because: This data has been previously made available to the public as part of a Federal rulemaking. It can be accessed through the following means: Docket EPA-HQ-OAR-2022-0829 “Modeling Input Files for the Air Quality and Benefits Analysis for the Light and Medium Duty Vehicle (LMDV) Multipollutant Final Rule (FRM)”. Format: The CMAQ model output files are netCDF format and include header metadata information describing all variables and variable units on the file. This dataset is associated with the following publication: Smith, E., K. Baker, M. El-Sayed, C. Hennigan, S. Rosanka, and A. Carlton. Gas-Phase Water-Soluble Organic Carbon: CMAQ Model Evaluation in Baltimore County. ACS Earth and Space Chemistry. American Chemical Society, Washington, DC, USA, 9(6): 1501-1509, (2025).
    0
    4 days ago
  • This dataset includes model ensemble results for the EMF37 study. This dataset is associated with the following publication: Bistline, J., M. Binstead , G. Blanford, G. Boyd, M. Browning, Y. Cai, J. Edmonds, A. Fawcett, J. Fuhrman, R. Gao, C. Harris, C. Hoehne, G. Iyer, J. Johnson, O. Kaplan, D. Loughlin, M. Mahajan, T. Mai, J. McFarland, H. McJeon, M. Melaina, S.S. Mousavi, M. Muratori, R. Orvis, A. Prabhu, C. Rossmann, R. Sands, L. Sarmiento, S. Showalter, A. Sinha, E. Starke, E. Stewart, K. Vaillancourt, J. Weyant, F. Wood, and M. Yuan. Policy implications of net-zero emissions: A multi-model analysis of United States emissions and energy system impacts. Energy and Climate Change. Elsevier B.V., Amsterdam, NETHERLANDS, 6: 100191, (2025).
    1
    4 days ago
  • Study raw data used to generate manuscript figures/tables. This dataset is associated with the following publication: Fiamingo (Fyle) same person, M., G. Little, M. Harmon, B.L. Martin, W. Oshiro, K. McDaniel, Y.H. Kim, I. Gilmour, A. Farraj, and M. Hazari. The impact of housing and high-fructose diet on behavior and cardiovascular response to eucalyptus wildfire smoke in WKY rats. JOURNAL OF TOXICOLOGY AND ENVIRONMENTAL HEALTH - PART A: CURRENT ISSUES. Taylor & Francis, Inc., Philadelphia, PA, USA, 1-20, (2025).
    1
    4 days ago
  • This is the complete dataset of the study MF_21_1, which investigates the impact of high living temperatures and housing on cardiopulmonary and behavioral function in mice and subsequent response to eucalyptus wildfire smoke. This dataset is associated with the following publication: Fiamingo, M., T. Jackson, S. Toler, W. Oshiro, K. McDaniel, L. Klein, K. Lee, P. Evansky, I. Gilmour, A. Farraj, and M. Hazari. The Impacts of Housing Conditions on the Cardiopulmonary and Neurobehavioral Responses of Mice to High Temperature and Wildfire Smoke. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(22): 10929-10943, (2025).
    1
    4 days ago
  • metadata entry for publication. Portions of this dataset are inaccessible because: data uploaded in ScienceHub. They can be accessed through the following means: contact first author on the paper. Format: Excel data file containing sampling locations, names, and all sampling data (nutrient, nitrate isotope, E. coli, and microbial source tracking data. This dataset is associated with the following publication: Zimmer-Faust, A., C. Brown, O. Shanks, W. Rugh, T.C. Mochon Collura, and H. Stecher. An integrated approach to coupled nutrient and microbial source tracking in an agricultural watershed. WATER RESEARCH. Elsevier Science Ltd, New York, NY, USA, (272): 122981, (2025).
    1
    4 days ago
  • This dataset contains the EPA-generated M3Dry, M3Dry-psn, and STAGE single point model data contributed to support the externally-led analysis in the manuscript "Ozone dry deposition through plant stomata: Multi-model comparison with flux observations and the role of water stress as part of AQMEII4 Activity 2". This dataset is associated with the following publication: Khan, A., O. Clifton, J. Bash, S. Bland, N. Booth, P. Cheung, L. Emberson, J. Fleming, E. Fredj, S. Galmarini, L. Ganzeveld, O. Gazetas, I. Goded, C. Hogrefe, C. Holmes, L. Horváth, V. Huijnen, Q. Li, P. Makar, I. Mammarella, G. Manca, W. Munger, J.L. Perez Camanyo, J. Pleim, L. Ran, R. San Jose, D. Schwede, S. Silva, R. Staebler, S. Sun, A. Tai, E. Tas, T. Vesala, T. Weidinger, Z. Wu, L. Zhang, and P. Stoy. Ozone dry deposition through plant stomata: Multi-model comparison with flux observations and the role of water stress as part of AQMEII4 Activity 2. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(15): 8613–8635, (2025).
    2
    4 days ago
  • The data contains electronic health records and PM2.5 exposure data in tabular format. The data contains information on vital measurements (heart rate and blood pressure), dates of hospitalizations, medication usage, and individual level demographics. This dataset is not publicly accessible because: The data contains PHI and PII which cannot be uploaded to ScienceHub or exported from their secure environment. It can be accessed through the following means: The data can be accessed by contacting Cavin Ward-Caviness or through a request to NC TraCS with appropriate approved IRB application. Format: The data contains electronic health records and PM2.5 exposure data in tabular format. The data contains information on vital measurements (heart rate and blood pressure), dates of hospitalizations, medication usage, and individual level demographics. This dataset is associated with the following publication: Narain, M., M. Breen, A. Carll, M. Hazari, A. Farraj, and C. Ward-Caviness. Modification of Associations Between PM2.5 and Vital Signs by β-Blocker Prescription Status Among Individuals with Heart Failure. ENVIRONMENTAL HEALTH. BioMed Central Ltd, London, UK, 24: 55, (2025).
    0
    4 days ago
  • Data: all sequencing data were deposited to the National Center for Biotechnology Information Sequence Read Archive under BioProject number PRJNA1251697. All alignments, scripts, population metadata, genotypes (filtered and unfiltered), and quantitative reverse-transcription PCR results are available on Dryad at the following link: https://doi.org/10.5061/dryad.sbcc2frh0. Code: this study does not report any original code. Additional information: any additional information required to reanalyze or use the data reported in this article is available from the lead contact upon request. This dataset is associated with the following publication: Nolan, C., I. Campbell, A. Farrell-Sherman, B. Briones Ortiz, C. Yang, K. Naish, V. Di Stilio, J. Kaldy, C. Donoghue, J. Ruesink, and T. Imaizumi. Florigen and antiflorigen gene expression correlates with reproductive state in a marine angiosperm, Zostera marina. iScience. Elsevier B.V., Amsterdam, NETHERLANDS, 28(8): 113082, (2025).
    1
    4 days ago
  • Variability in river discharge, particularly very high flow and low flow conditions, has far-reaching environmental and economic consequences. The retention of water in surface storage, concentrated in lakes, ponds, wetlands, floodplains, and temporary water in flood prone areas, can potentially contribute to flow generation and flood regulation. However, the impact of surface water storage on river discharge can be challenging to isolate and quantify. A suite of hydrologic signatures were generated for 72 gages across the conterminous United States. The hydrologic signatures were selected to characterize all flows as well as isolating high and low flows, and machine learning models were developed to explain watershed variability in signature values. Wetland related variables, including multi-sensor-based surface water extent and hydroperiod, were compared with other drivers, including climate, topography, and land cover. An improved understanding of how surface water dynamics influence river discharge can be used to improve the resilience of river systems to climate extremes. This dataset is associated with the following publication: Vanderhoof, M., P. Nieuwlandt, H. Golden, C. Lane, J. Christensen, W. Keenan, and W. Dolan. Relating surface water dynamics in wetlands and lakes to spatial variability in hydrologic signatures. Wetlands Ecology and Management. Springer Science and Business Media B.V;Formerly Kluwer Academic Publishers B.V., GERMANY, 33(53): 1-36, (2025).
    1
    4 days ago
  • These data were collected by the EPA Toxic Element Bioavailability Laboratory and consists of lead (Pb) and/or arsenic (As) mouse tissue, soil, aqueous soil leachate, and spectroscopy data. The mouse-based assay for assessment of lead and arsenic in vivo mouse bioavailability in soil and dust is a critical tool needed to improve our understanding of the factors affecting the metal’s uptake across the gastrointestinal barrier and to evaluate the efficacy of methods used to remediate lead and/or arsenic contaminated media. The mouse assay has been optimized to yield accurate, reproducible, and reliable estimates of the in vivo mouse bioavailability of lead and/or arsenic in soil and dust. The reported Pb/As data is used to assess the total, bioaccessible, and bioavailable concentrations resulting from exposure to soils. These data were collected using EPA Methods 1340, 3050b, 6010d, and 6020b. These quantitative characterization data are then paired with X-ray absorption spectroscopy data that is used to deduce the valence, coordination environment, and mineral/sorbed phase of the element of interest. These data are collected at a synchrotron facility by our team and then processed at EPA ORD using previously established methods (e.g., Sowers et al., 2023).
    1
    4 days ago
  • This study uses the hierarchical CAFE (Cropping system, Animal-crop system, Food system, and Ecosystem) framework to evaluate nutrient management performances within the Chesapeake Bay watershed. This dataset contains a three-decade, county-level nutrient budget (1985–2019), which can be used to analyze the spatiotemporal patterns of N and P budgets, as well as N and P use efficiencies, within the four CAFE hierarchies. This dataset is associated with the following publication: Zou, T., E. Davidson, R. Sabo, G. MacDonald, and X. Zhang. Disparities in nitrogen and phosphorus management across time and space: a case study of the Chesapeake Bay using the CAFE framework. Environmental Research Letters. IOP Publishing LIMITED, Bristol, UK, Volume 19: 110016, (2024).
    1
    4 days ago
  • Real-time USGS nitrate data are collected to map short-term changes in nitrate concentrations across locations in the US: https://waterwatch.usgs.gov/wqwatch/?pcode=00630 CAMELS data are “a large-sample watershed-scale hydrometeorological dataset for the contiguous USA” (see https://gdex.ucar.edu/dataset/camels.html) BasinATLAS for catchment attributes related to land cover, soils, and geology: https://developers.google.com/earth-engine/datasets/tags/hydroatlas DAYMET meteorological data for temperature and precipitation: https://daymet.ornl.gov/. This dataset is not publicly accessible because: Publicly available data. It can be accessed through the following means: https://waterwatch.usgs.gov/wqwatch/?pcode=00630 https://gdex.ucar.edu/dataset/camels.html https://developers.google.com/earth-engine/datasets/tags/hydroatlas https://daymet.ornl.gov/. Format: Real-time USGS nitrate data, CAMELS streamflow data, BasinATLAS catchment attribute data, and DAYMET meteorological data. This dataset is associated with the following publication: Pandit, A., H. Golden, J. Christensen, C. Lane, and A. Husic. Deep Learning Prediction and Interpretation of Riverine Nitrate Export Across the Mississippi River Basin. WATER RESOURCES RESEARCH. American Geophysical Union, Washington, DC, USA, 61(8): e2024WR039207, (2025).
    0
    4 days ago
  • Supporting data for an internal EPA report and peer reviewed journal article on refinement, standardization, and performance of a four-day Daphnia magna survival and growth test method. Version 1: reviewed internally by co-authors but not peer reviewed. Includes chemical analysis data, preliminary study data, raw toxicity test data, additional endpoints, and additional statistical power tables. This dataset is associated with the following publication: Kadlec, S., J. Lazorchak, D. Mount, and S. Goodrich. DAPHNIA MAGNA 4-DAY SURVIVAL AND GROWTH TEST. U.S. Environmental Protection Agency, Washington, DC, USA.
    1
    4 days ago
  • This dataset provides information on the gene regulation by single and repeated exposure to lower dose of burn pit smoke condensates and biological changes at 48 hrs post-exposure depending on different combustion conditions. The findings suggest that exposure to burn pit smoke condensates may impart a lasting adverse impact on human respiratory health, and the sustained effects depend on the waste source material and combustion condition. This dataset is associated with the following publication: Ghosh, A., K. Rogers, S. Gallant, S. Brocke, A. Speen, Y.H. Kim, I. Gilmour, S. Randell, and i. jaspers. Simulated burn pit smoke condensates cause sustained impact on human airway epithelial cell. TOXICOLOGICAL SCIENCES. Society of Toxicology, RESTON, VA, 204(1): 2-8, (2025).
    3
    4 days ago
  • Excel file of all data pertaining to the manuscript. It contains metabolomic and genomic data with GEO number for the given study. This dataset is associated with the following publication: Alewel, D., K. Rentschler, T. Jackson, M. Schladweiler, A. Astriab Fisher, P. Evansky, and U. Kodavanti. Serum metabolome and liver transcriptome reveal acrolein inhalation-induced sex-specific homeostatic dysfunction. Scientific Reports. Nature Publishing Group, London, UK, 13: 21179, (2023).
    1
    4 days ago
  • Hydrochar derived from the hydrothermal carbonization of wheat straw at 180 °C modified with 3-Aminopropyl triethoxysilane to enhance its versatile adsorption of Pb(II), Cu(II), methylene blue, and reactive red. This dataset is not publicly accessible because: Non-EPA data. Owned by University of Florida. It can be accessed through the following means: Contact Dr. Zhang,Yue at the University of Florida. Format: Excel data and images files, about 5MB. This dataset is associated with the following publication: Zhang , Y., Y. Wan, Y. Zheng , Y. Yang, J. Huang, H. Chen, J. Chen, A. Mosa, and B. Gao. Hydrochar loaded with nitrogen-containing functional groups for versatile removal of cationic and anionic dyes and aqueous heavy metals. WATER. MDPI, Basel, SWITZERLAND, 16(23): 3387, (2024).
    0
    4 days ago
  • The data consist of caffeine sorption experimental data with spent coffee ground biochar, both pristine and ball-milled, as sorbents. This dataset is not publicly accessible because: Non-EPA-owned by the University of Florida. It can be accessed through the following means: Contact Dr. Yang, Yicheng from University of Florida at . Format: Microsoft Excel file (about 3000 KB) Images (JPEGs) file (about 15MB). This dataset is associated with the following publication: Yang, Y., Y. Wan, J. Chen, H. Chen, Y. Li, R. Rafael Munoz-Carpena , Y. Zheng , J. Huang, Y. Zhang , and B. Gao. Ball-milled spent coffee ground biochar effectively removes caffeine from water. WATER. MDPI, Basel, SWITZERLAND, 17(6): 881, (2025).
    0
    4 days ago
  • This data set was obtained from lab experiments using Fe-Mn modified biochar (BFM) in fixed bed filtration columns to remove polystyrene microplastics (PS-MPs) and sulfamethoxazole (SMX) in both water (pH ≈ 5.6) and selected wastewater (pH ≈ 8). This dataset is not publicly accessible because: Not generated by EPA - owned by the University of Florida. It can be accessed through the following means: Contact Dr. Huang, Jinsheng of the University of Florida. Format: Excel files and images, 5 MB. This dataset is associated with the following publication: Huang, J., A. Zimmerman, Y. Wan, X. Bai, H. Chen, Y. Zheng , Y. Zhang , Y. Yang, Y. Fan, and B. Gao. Removal of sulfamethoxazole using Fe-Mn biochar filtration columns: Influence of co-existing polystyrene microplastics. JOURNAL OF CLEANER PRODUCTION. Elsevier Science Ltd, New York, NY, USA, 477: 143877, (2024).
    0
    4 days ago
  • Emission input and other input for running CMAQ model. This dataset is not publicly accessible because: Own by the collaborators. It can be accessed through the following means: send a request to the corresponding author. Format: netCDF format. This dataset is associated with the following publication: Wang, Q., Y. Li, F. Zhong, W. Wu, H. Zhang, R. Wang, Y. Duan, Q. Fu, Q. Li, L. Wang, S. Yu, A. Mellouki, D. Wong, and J. Chen. Ground ozone rise during the 2022 Shanghai lockdown caused by the unfavorable emission reduction ratio of nitrogen oxides and volatile organic compounds. ATMOSPHERIC ENVIRONMENT. Elsevier B.V., Amsterdam, NETHERLANDS, 340: 120851, (2025).
    0
    4 days ago
  • This Dataset includes the spatial and temporal quantification of planktothrix cyanobacteria filaments within the canal and river system of St. Mary's, OH for the year 2023.
    1
    4 days ago
  • This Dataset includes the spatial and temporal quantification of planktothrix cyanobacteria filaments within the canal and river system of St. Mary's, OH for the year 2022.
    1
    4 days ago
  • The data set includes the sample metadata, quantitative data of measurements of SARS-CoV-2 gene fragments in wastewater and variant presence interpreted from sequence data. This dataset is associated with the following publication: Nagarkar, M., S. Keely, E. Wheaton, C. Hart, M. Jahne, J. Garland, E. Varughese, and N. Brinkman. Dynamics of SARS-CoV-2 Variants in Southwest Ohio Municipal Wastewater. Environmental Science: Water Research & Technology. Royal Society of Chemistry, Cambridge, UK, 11(6): 1494-1504, (2025).
    1
    4 days ago
  • After a wide-area biological contamination incident populations residing within minimally contaminated areas may be instructed to shelter-in-place and need to perform infection control within their homes. Previous research within HSMMD has found hot water laundering effective for the decontamination of Phi6 bacteriophage and hot water laundering + bleach effective for the decontamination of the B. anthracis surrogate Bg. This dataset expands upon previous work to include six different laundering methods, some including sanitizers, and four different microorganisms (Phi6, MS2, Klebsiella pneumoniae, and Staphylococcus aureus). The dataset includes eight different textiles.
    1
    4 days ago
  • This dataset describes the estimates of gridded nitrogen fixation from various sources globally. The global gridded datasets of BNF generated here are available in the ScienceBase repository (https://www.sciencebase.gov/catalog/item/66a97480d34e07a119db3a37). The underlying BNF rate dataset in natural terrestrial biomes is also available in the ScienceBase repository (https://www.sciencebase.gov/catalog/item/66a97365d34e07a119db3a30). All other data are available from the databases cited or are in the main text or the supplementary materials. The links will be made active upon acceptance. Portions of this dataset are inaccessible because: See link above. They can be accessed through the following means: See link above. Format: See link above. This dataset is associated with the following publication: Reis Ely, C.R., S.S. Perakis, C.C. Cleveland, D.N.L. Menge, S.C. Reed, B.N. Taylor, S.A. Batterman, C.M. Clark, T.E. Crews, K.A. Dynarski, M. Gei, M.J. Gundale, D.F. Herridge, S.E. Jovan, S. Kou-Giesbrecht, M.B. Peoples, J. Piipponen, E. Rodríguez-Caballero, V.G. Salmon, F.M. Soper, A.P. Staccone, B. Weber, C.A. Williams, and N. Wurzburger. Global terrestrial nitrogen fixation and its modification by agriculture. NATURE. Nature Portfolio, Berlin, GERMANY, 643(8072): 705-711, (2025).
    1
    4 days ago
  • Indoor rainfall observations were conducted at the Environmental Protection Agency (EPA) Fluid Modeling Facility (FMF) laboratory (35.887°N, 78.841°W, 123 meters above sea level), which is located 3.2 miles east of the EPA Research Triangle Park (RTP) campus in Durham, North Carolina. For the outdoor rainfall collection another Parsivel2 disdrometer was installed on the EPA RTP campus (35.881°N, 78.871°W, 98 meters above sea level) in Durham, North Carolina, US. A total of ten daily rainfall events were collected from June 5 to July 29, 2024.
    17
    4 days ago
  • This data is from Lee et al. which used the LCMAP to estimate the amount of cropland expansion onto critical habitat in the U.S, and the causes of those land use changes. This dataset is associated with the following publication: Lee, Y.S., C. Clark, K. Austin, G. Martin, and C. Cowell. Conversion of species’ critical habitats and ranges in the U.S.: Contributions from ethanol production and other factors. JOURNAL OF ENVIRONMENTAL MANAGEMENT. Elsevier Science Ltd, New York, NY, USA, 389: 126050, (2025).
    1
    4 days ago
  • Model results to examine ozone sensitivity to high energy demand in New York City. This dataset is not publicly accessible because: We don't have it. It can be accessed through the following means: Contact Alexandra Karambelas, Northeast States for Coordinated Air Use Management, Boston, MA. Format: Model results to examine ozone sensitivity to high energy demand in New York City. This dataset is associated with the following publication: Karambelas, A., P. Miller, J. Underhill, J. Pleim, E. Zalewsky, and J. Jakuta. Ozone sensitivity to high energy demand day electricity and onroad emissions during LISTOS. JOURNAL OF THE AIR & WASTE MANAGEMENT ASSOCIATION. Air & Waste Management Association, Pittsburgh, PA, USA, 74(11): 804-819, (2024).
    0
    4 days ago
  • This dataset contains final post-processed values used to generate all figures in the manuscript titled Thermal treatment of hexafluoropropylene oxide dimer acid (HFPO-DA) using a pilot-scale research combustor. This dataset is associated with the following publication: Weber, N., G. West, W. Roberson, J. Mackie, J. Mattila, P. Burnette, M. Allen, W. Preston, B. Linak, and J. Krug. Thermal treatment of hexafluoropropylene oxide dimer acid (HFPO-DA) using a pilot-scale research combustor. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 495: 0, (2025).
    1
    4 days ago
  • Tatters, A., S. Clark, and R. Labiosa. 2025. June 2025 Phytoplankton Counts from Southern Puget Sound and Surrounding Lakes. The phytoplankton counts and associated environmental conditions, collected with YSI probes, in this spreadsheet represent grab samples collected in southern Puget Sound and connected lakes in June 2025 in support of an EPA Region 10 ROAR project: Saving Puget Sound from Eutrophication (SPSE): Coupling River Basin Export Reduction Optimization Support Tool (RBEROST) with Dynamic SPARROW model. They are covered by QAPP: J-ACESD-0034452-QP-1-0 and SOP #J‐GEMMD‐EDEB‐SOP‐4403‐1
    1
    4 days ago
  • This is the readme and metadata for the data entitled “Quantifying the Land-Use Change Due to Soybean-Based Biodiesel in the United States” by Miao et al., that was published in the journal Applied Economic Perspectives & Policy (https://onlinelibrary.wiley.com/doi/10.1002/aepp.70005). The data shows the county FIPS code and the amount of soybean acreage increase and total cropland acreage increase from changes in soybean price and biodiesel production over 2011-2020.
    2
    4 days ago
  • The data presented in this study are openly available within the manuscript and its Supporting Information Files. The quality assurance project plan (QAPP), the standard operating procedure (SOP), and the Arduino IDE program file related to the Mayfly version 1.0 data logger board will be available upon request. Details on the summary of literature for prioritizing the contaminants of concerns related to roof rainwater harvesting; examples of QAQC equipment calibration or operational check log sheets; summary of the missing TEST sensor raw data; and statistical summary of the split clean data (Tables S1–S10). Research site location; low-cost sensors; data logger board; QAQC equipment; data cleaning approach; raw TEST sensor data compared with QAQC sensor data; logger box ambient condition data; and TEST sensors’ clean data along with the correlations among various combination of the three parameters (Figures S1–S8); additional reference.
    3
    4 days ago
  • Kazi Aminul Islam at Kennesaw State University is the owner of the analysis data. Contact the lead author at kislam4@kennesaw.edu. This dataset is not publicly accessible because: NGA Nextview and NASA Commercial Data Buy license agreements prohibit the distribution of original data files from WorldView due to copyright. It can be accessed through the following means: N/A. Format: Original data files from WorldView. This dataset is associated with the following publication: Islam, K., O. Abul-Hassan, H. Zhang, V. Hill, B. Schaeffer, R. Zimmerman, and J. Li. Ensemble Machine Learning Approaches for Bathymetry Estimation in Multi-Spectral Images. Geomatics. MDPI, Basel, SWITZERLAND, 5(3): 34, (2025).
    0
    4 days ago
  • Gas fluxes (carbon dioxide, methane, nitrous oxide), sediment, environmental variables, nutrients, eelgrass and macroalgae data collected from coastal lagoons in southern Rhode Island in 2022 and 2023.
    1
    4 days ago
  • Limited data is available for physicochemical properties and environmental fate parameters of PFAS chemicals, which are widely distributed in the environment and highly persistent. This work assesses available models for estimation of hydrolysis rates and pKa values for their predictive performance for PFAS chemicals. This dataset is associated with the following publication: Lazare, J., C. Stevens, E. Weber, and L. Shields. p Ka Data-Driven Insights into Multiple Linear Regression Hydrolysis QSARs: Applicability to Perfluorinated Alkyl Esters. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(23): 11745-11755, (2025).
    4
    4 days ago
  • These data are extracted from output from the Community Multiscale Air Quality (CMAQ) model run with inputs and simulations generated by the EQUATES project. Pollutant concentrations are pulled from the model gridcell corresponding to Baltimore, Maryland, where the measurements for this study were taken. This dataset is associated with the following publication: Sapkota, S., P. Shekhar, B. Murphy, H. Pye, C. Hennigan, and M. El-Sayed. Seasonal Assessment of Secondary Organic Aerosol Formed through Aqueous Pathways in the Eastern United States. ACS Earth and Space Chemistry. American Chemical Society, Washington, DC, USA, 9(4): 876-887, (2025).
    13
    4 days ago
  • No new EPA data were generated. This dataset is not publicly accessible because: The data will be released by the journal after publication of special issue. It can be accessed through the following means: The full set of data will be available via the Energy and Climate Change journal website. Format: This manuscript involves the analysis of data submitted by large number of modeling teams from different organizations in support of the Energy Modeling Forum 37 model intercomparison exercise. EPA's TIMES results are included, but were submitted to Science Hub previously (SI#354850). No additional EPA data were created in the development of this manuscript. This dataset is associated with the following publication: Sands, R., L. Wachs, P. Lamers, O. Bahn, R. Beach, M. Binsted, G. Blanford, Y. Cai, F. De La Chesnaye, J. Edmonds, L. Goke, C. Harris, C. Hoehne, G. Kim, P. Kyle, H. McJeon, R. Orvis, S. Showalter, A. Sinha, E. Starke, K. Vaillancourt, N. Victor, P. Volkmar, J. Weyant, and F. Wood. Bioenergy pathways within United States net zero CO2 emissions scenarios in the Energy Modeling Forum 37 study. Energy and Climate Change. Elsevier B.V., Amsterdam, NETHERLANDS, 6: 100209, (2025).
    0
    4 days ago
  • This EnviroAtlas dataset contains projected change in 30-year normals in maximum temperature, minimum temperature, evapotranspiration, and precipitation, for Alaska, Hawaii, Puerto Rico, the U.S. Virgin Islands, American Samoa, Guam and Commonwealth of the Northern Mariana Islands. This dataset was created using the NASA Earth Exchange-Global Daily Downscaled Projections (NEX-GDDP), developed using Global Climate Models (GCMs) runs conducted under the Coupled Model Intercomparison Project Phase 6 (CMIP6) across four scenarios, known as Shared Socioeconomic Pathways (SSPs). The four SSPs involved in this project are SSP1-2.6, SSP2-4.5, SSP3-7.0, and SSP5-8.5. The raw NEX-GDDP-CMIP6 data has a spatial resolution of 0.25 degrees and a daily temporal resolution. The NEX-GDDP-CMIP6 data was processed to calculate projected changes in six climatic variables for each season (fall, spring, summer, winter) and annually for five 30-year periods: recent history (1976-2005) to near-term future (2025-2054) recent history (1976-2005) to mid-century (2045-2074) recent history (1976-2005) to end-of-century (2070-2099) near-term future (2025-2054) to mid-century (2045 to 2074) near-term future (2025-2054) to end-of-century (2070 to 2099) The six climatic variables included in the dataset are change in: total precipitation [in and fraction] total potential evapotranspiration [in and fraction] maximum temperature [degF], and minimum temperature [degF]. This data was then used to produce an NEX-GDDP-CMIP6 ensemble median for each variable for each HUC12. Not all GCMs downscaled in NEX-GDDP-CMIP6 had availability for every variable and scenario combination. Due to low historical values in precipitation and potential evapotranspiration, the data for Alaska is not available in fraction unit. This dataset was produced by the US EPA to support research and online mapping activities related to EnviroAtlas. EnviroAtlas (https://www.epa.gov/enviroatlas) allows the user to interact with a web-based, easy-to-use, mapping application to view and analyze multiple ecosystem services for the contiguous United States. EnviroAtlas includes a user-friendly interactive map for data discovery, https://enviroatlas.epa.gov/enviroatlas/interactivemap.
    5
    4 days ago
  • Data for figures involving model results in the "Users' Guide for GLIMPSE: a Tool for Integrated Air-Climate-Energy Planning, Version 1.0".
    1
    4 days ago
  • The links in this ScienceHub entry provide a path to access archived data collected by EPA ORD researchers contributing to this publication. These include datasets collected at a number of locations within the United States in collaboration with various state and local air monitoring agencies. The data files relevant to this publication are those archiving the Pandora level 0 radiance measurements, from which total column formaldehyde is retrieved, and compared to that retrieved from airborne and satellite-based radiance measurements. Each dataset has a DOI included in its metadata, with contract information for relevant principal investigators and data managers. These DOI are generated by NASA and by the Pandonia Global Network through collaborations with EPA Office of Research and Development. This dataset is associated with the following publication: Rawat, P., J. Crawford, K. Travis, L.M. Judd, M.A. Demetillo, L. Valin, J. Szykman, A. Whitehill, E. Baumann, and T. Hanisco. Maximizing the scientific application of Pandora column observations of HCHO and NO2. Atmospheric Measurement Techniques. Copernicus Publications, Katlenburg-Lindau, GERMANY, 18(13): 2899-2917, (2025).
    1
    4 days ago
  • The human-subjects dataset includes questionnaire responses, socioeconomic and other personal attributes, and neighborhood green-space metrics linked to individual respondents within a SAS database. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: Request permission to work with individual-level data from the Survey of the Health of Wisconsin (SHOW) from Dr. Kristen Malecki, principal investigator, University of Wisconsin-Madison (kmalecki@wisc.edu). Format: The human-subjects dataset includes questionnaire responses, socioeconomic and other personal attributes, and neighborhood green-space metrics linked to individual respondents within a SAS database. This dataset is associated with the following publication: Tsai, W., L. Yngve, Y. Zhou , K. Beyer, A. Bersch, K. Malecki, and L. Jackson. Street-level neighborhood greenery linked to active transportation: A case study in Milwaukee and Green Bay, WI, USA. LANDSCAPE AND URBAN PLANNING. Elsevier Science Ltd, New York, NY, USA, 191: 103619, (2019).
    0
    4 days ago
  • Datasets include maps and excel spreadsheet data files used in modeling the combined impacts of fluvial flooding, mean higher high water tide, and sea level rise on sediment and contaminant transport at legacy landfills in the Lower Darby Creek Area (LDCA) Superfund site. This dataset is associated with the following publication: Woznicki, S., J. Barber, J. Butcher, J. Essoka, H. Maureen, M. Mehaffey, B. Pluta, A. Shabani, and P. Whung. Compound Impacts of Fluvial Flooding and Sea-Level Rise on Benzo[a]pyrene Transport in the Lower Darby Creek Area Superfund Site, Pennsylvania, USA. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 5(7): 3613-3627, (2025).
    6
    4 days ago
  • Complete dataset for "Impact of soil load on microorganism inactivation by 222 nm and 254 nm UVC radiation" manuscript. This dataset is associated with the following publication: Ratliff, K., M. Calfee, A. Abdel-Hady, M. Monge, D. Aslett, and L. Oudejans. Impact of inoculum composition on bacteria and bacteriophage UVC inactivation at 222 nm and 254 nm. Letters in Applied Microbiology. Blackwell Publishing, Malden, MA, USA, 78(7): ovaf090, (2025).
    1
    4 days ago
  • This Excel file contains data collected over three years (2021-2023) at the aquaculture farm in Potter Pond, RI, and one year (2023) at Pt Judith aquaculture farm in Pt Judith, RI. The data collected are chlorophyll a concentrations, turbidity, depth, clarity, weather variables, wind speed and direction, water flow speed and direction, nutrient concentrations.
    1
    4 days ago
  • Transportation of damaged, defective, or recalled (DDR) lithium-ion batteries (LIBs) of is an important emerging issue as the use of electronic vehicles (EVs) and other LIB based items proliferate. Additionally, since these battery cathodes are made up of lithium nickel manganese cobalt oxide (NMC), lithium iron phosphate (LFP), lithium manganese oxide (LMO), and lithium cobalt oxide (LCO), there is an interest in the safe recovery of critical minerals, such as lithium, cobalt, and nickel, and other scarce resources from this source. These DDR LIBs must be de-energized to safe voltage levels, identified as below 1.0 V, to reduce the risk of fire and explosion during transport from crash sites, floods, wildfires, etc. Sodium chloride (NaCl) solutions are typically used to electrochemically discharge LIBs, but these solutions can cause battery terminals to corrode, leading to solid residue, fluoride ion buildup, release of toxic gases to the air, and release of corrosion solids and battery electrolytes into the solution. Because of these drawbacks, alternatives for discharging DDR LIBs must be sought. In this project, different LIB discharge methods identified in the literature will be tested for their ability to adequately de-energize DDR LIBs to a safe level, and the environmental effects of these methods (e.g., off-gassing, waste, etc.) will be evaluated to find an effective, safe, and environmentally-sound replacement for NaCl solutions. The potential alternatives that have been identified are iron sulfate (FeSO4), sodium bicarbonate (NaHCO3), magnesium chloride (MgCl2), sodium hydroxide (NaOH) and sugar. These were specifically identified as each is readily available are common grocery or home goods stores and would thus be available to on-scene coordinators responding to a disaster scene. The environmental impact of these different discharging methodologies will be evaluated via the analysis of any byproduct formation and monitoring of physical battery condition during discharge.
    1
    4 days ago
  • Newly recovered xenoliths from the modern backarc region in southern Peru were collected to investigate the metasomatic history of the northern Altiplano lithosphere and improve constraints on the formation of recent potassic magmatism in the region. The xenoliths described here were collected from a Quaternary latite lava flow near Huarocondo, Peru and include calcite-bearing phlogopite-orthopyroxenites, harzburgites, a wehrlite, and a phlogopite schist. Xenoliths were analyzed for C and O stable isotope ratios of calcite, H stable isotope ratios of phlogopite, and Sr isotope ratios of calcite, silicates, and phlogopite separates. Mineral chemical analyses where performed on orthopyroxenite and harzburgite xenoliths via electron microbrobe, and bulk rock trace element analyses of all xenoliths were performed via ICPMS. New bulk rock major and trace element analyses of four Quaternary lavas flows belonging to the Rumicolca Formation are also presented. For a detailed discussion of the research motivation, geologic background, analytical techniques, and interpretations, please refer to the related publication. This dataset is associated with the following publication: Hiett, C., D. Newell, and J. Shervais. Metasomatism and Melting of Cordilleran Lithosphere Resulting From Sediment Relamination During Shallow Subduction. Geochemistry, Geophysics, Geosystems (G3). American Geophysical Union, Washington, DC, USA, 26(7): e2025GC012300, (2025).
    1
    4 days ago
  • The data presented in the workbook were from a ACESD/CEMM/ORD 2021 research project conducted in mesocosms in the greenhouse to examine relationships between the presence/absence of oysters (Crassostrea virginica) and ambient/tempered seawater on the growth of eelgrass, Zostera marina.
    1
    4 days ago
  • This dataset provides example code for regression analysis of observed versus estimated chlorophyll from Sentinel 2 satellite imagery based on three different algorithms. In addition, data used in the production of figures 1-3 of Wolters et al. (2025) Evaluation of atmospheric preprocessing methods and chlorophyll algorithms for Sentinel 2 imagery in coastal waters, submitted to journal Remote Sensing.
    4
    4 days ago
  • High resolution spatial stream network (SSN) models are needed to predict stream temperature distributions across large basins at a fine scale, to identify thermal refuge areas for conservation and protection, and to predict the effects of weather variation and management actions on coldwater habitat.  EPA has been working with the Penobscot tribe and Maine Temperature Monitoring Working Group to plan development of a fine scale temperature model for the Penobscot River basin in Maine.  This suite of datasets with supporting Python code provides calibration and prediction covariates for a fine resolution SSN model for the Penosbscot.  Included are estimates of effective shade from both topographic and vegetation features for different upstream extents (based on both distance and time of travel).  At this point model development has not been initiated.
    8
    4 days ago
  • High resolution spatial stream network (SSN) models are needed to predict stream temperature distributions across large basins at a fine scale, to identify thermal refuge areas for conservation and protection, and to predict the effects of weather variation and management actions on coldwater habitat.  EPA has been working with the Penobscot tribe and Maine Temperature Monitoring Working Group to plan development of a fine scale temperature model for the Penobscot River basin in Maine.  This suite of datasets with supporting Python code provides calibration and prediction covariates for a fine resolution SSN model for the Penosbscot.  Included are an SSN object with catchment covariates, associated Python code and metadata.  At this point model development has not been initiated.
    8
    4 days ago
  • PFAS data in bivalves from the Delaware Bay. This dataset is not publicly accessible because: Not EPA data. It can be accessed through the following means: Contact Miling Li, University of Delaware - https://www.miling-li.com/. Format: NA. This dataset is associated with the following publication: Jones, S.E., N. Gutkowski, S. Demick, M. Curello, A. Pavia, A. Robuck, and M. Li. Assessing Bivalves as Biomonitors of Per- and Polyfluoroalkyl Substances in Coastal Environments. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(10): 5202 - 5213, (2025).
    0
    4 days ago
  • A High-throughput Method (HTM) for processing Sponge-Stick Samples to detect Bacillus anthracis - spore-forming biothreat agent for anthrax - was recently developed. The current dataset is for a manuscript which describes how the High-throughput Method (HTM) developed for the spore-forming biothreat agent was adapted and evaluated for the non-spore forming biothreat agents, Yersinia pestis (causes Plague) and Francisella tularensis (causes Tularemia). This dataset is associated with the following publication: Brisson, V., S. Kane, M. Calfee, S. Cendrowski, and S. Shah. Evaluation of a High-Throughput Processing Method for Sponge-Stick Samples to Detect Viable, Non-Spore-Forming Biothreat Agents. JOURNAL OF MICROBIOLOGICAL METHODS. Elsevier Science Ltd, New York, NY, USA, 236: 107194, (2025).
    2
    4 days ago
  • Dataset summarizes the concentrations of CECs in groundwater impacted by onsite septic systems.
    1
    4 days ago
  • The links in this ScienceHub entry provide a path to access archived data collected by EPA ORD researchers contributing to this publication. These include datasets collected in New Jersey, Connecticut and New York. These data collection efforts contributed to the larger Long Island Sound Tropospheric Ozone Study (LISTOS), 2023. The data files relevant to this publication are those archiving ground-based in situ formaldehyde data measurements and the Pandora level 0 radiance measurements, from which total column formaldehyde is retrieved, and compared to that retrieved from airborne and satellite-based radiance measurements. Each dataset has a DOI included in its metadata, with contract information for relevant principal investigators and data managers. These DOI are generated by NASA and by the Pandonia Global Network through collaborations with EPA Office of Research and Development. This dataset is associated with the following publication: Tao, M., A. Fiore, A. Karambelas, P. Miller, L. Valin, L. Judd, M. Tzortziou , A. Whitehill, A. Teora, Y. Tian, K. Civerolo, D. Tong, S. Ma, S. Adamo, and T. Holloway. Insights Into Summertime Surface Ozone Formation From Diurnal Variations in Formaldehyde and Nitrogen Dioxide Along a Transect Through New York City. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 130(9): e2024JD040922, (2025).
    2
    4 days ago
  • The links in this ScienceHub entry provide a path to access archived data collected by EPA ORD researchers contributing to this publication. These include datasets collected in Olympic Park, Seoul, Republic of Korea; Taehwa Mountain, Republic of Korea; and along Long Island Sound in Connecticut and New York. These data collection efforts contributed to the larger field measurement missions named KORUS-AQ and LISTOS. The data files relevant to this publication are those archiving ground-based in situ formaldehyde data measurements and the Pandora level 0 radiance measurements, from which total column formaldehyde is retrieved, and compared to that retrieved from airborne and satellite-based radiance measurements. Each dataset has a DOI included in its metadata, with contract information for relevant principal investigators and data managers. These DOI are generated by NASA and by the Pandonia Global Network through collaborations with EPA Office of Research and Development. This dataset is associated with the following publication: Travis, K., J.M. Judd, J. Crawford, G. Chen, J. Szykman, A. Whitehill, L. Valin, E. Spinei, S.J. Janz, C. Nowlan, A. Fried, H. Kwon, and J. Walega. Can column formaldehyde observations inform air quality monitoring strategies for ozone and related photochemical oxidants?. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union, Washington, DC, USA, 127(13): e2022JD036638, (2022).
    3
    4 days ago
  • This data set provides means and variance for all figures included in the manuscript. This dataset is associated with the following publication: Murr, A., A. Buckalew, G. DeVane, J. Bailey, J. Ford, L. Gray, and T. Stoker. Peripubertal exposure to oxyfluorfen, a diphenyl herbicide, delays pubertal development in the male rat by antagonizing androgen receptor activity.. TOXICOLOGICAL SCIENCES. Society of Toxicology, RESTON, VA, 203(2): 206-215, (2025).
    1
    4 days ago
  • Emission and other input to run the CMAQ model for this particular study. This dataset is not publicly accessible because: Own by the collaborators. It can be accessed through the following means: send a request to the corresponding author. Format: netCDF format. This dataset is associated with the following publication: Yi, X., G. Sarwar, J. Bian, L. Huang, Q. Li, S. Jiang, H. Liu, Y. Wang, H. Chen, T. Wang, J. Chen, A. Saiz-Lopez, D. Wong, and L. Li. Significant Impact of Reactive Chlorine on Complex Air Pollution Over the Yangtze River Delta Region, China. JOURNAL OF GEOPHYSICAL RESEARCH: ATMOSPHERES. American Geophysical Union. Washington, DC, USA, 128: e2023JD038898, (2023).
    0
    4 days ago
  • WRF driven data: 6-hourly National Centers for Environmental Prediction Final operational global analysis data initial and boundary conditions: daily average Hemispheric CMAQ output in 2015 provided by the US EPA emission data: * EGGAR version 5 for the base year 2015 with a grid resolution of 0.1 deg x 0.1 deg * the global fire emission database version 4 for the biomass burning emission in 2015. This dataset is not publicly accessible because: The data is owned by the authors and they do want to be shared. It can be accessed through the following means: send a request to the corresponding author: Prof. Jimmy Fung, majfung@ust.hk. Format: All data is in netCDF format WRF driven data: 6-hourly National Centers for Environmental Prediction Final operational global analysis data initial and boundary conditions: daily average Hemispheric CMAQ output in 2015 provided by the US EPA emission data: * EGGAR version 5 for the base year 2015 with a grid resolution of 0.1 deg x 0.1 deg * the global fire emission database version 4 for the biomass burning emission in 2015. This dataset is associated with the following publication: Huang , Y., X. Lu , J. Fung , D. Wong, Z. Li , Y. Chen, and W. Chen. Investigating Southeast Asian biomass burning by the WRF-CMAQ two-way coupled model: Emission and direct aerosol radiative effects. ATMOSPHERIC ENVIRONMENT. Elsevier B.V., Amsterdam, NETHERLANDS, 294: 119521, (2023).
    0
    4 days ago
  • The emission data which includes area and point sources, are directly from the 2016 CMAQ US CONUS domain (stored on atmos asm system, /asm/MOD3DATA/2016_12US1/emis/cb6r3_ae6_20190221). This dataset is not publicly accessible because: the data is too large for ScienceHub to host it. It can be accessed through the following means: contact the corresponding author. Format: netCDF format. This dataset is associated with the following publication: Walters, M., and C. Wong. The impact of altering emission data precision on compression efficiency and accuracy of simulations of the community multiscale air quality model. Geoscientific Model Development. Copernicus Publications, Katlenburg-Lindau, GERMANY, 16(4): 1179–1190, (2023).
    0
    4 days ago
  • Estimated counts of wildfire-related premature deaths. This dataset is associated with the following publication: Law, B.E., J.T. Abatzoglou, C.R. Schwalm, D. Byrne, N. Fann, and N.J. Nassikas. Anthropogenic climate change contributes to wildfire particulate matter and related mortality in the United States. Communications Earth & Environment. Springer Nature, LONDON, UK, 6(1): 336, (2025).
    1
    4 days ago
  • subbasins for the Upper MIssissippi River Basin and total surface water storage estimates from remote sensing and from SWAT estimates. This dataset is not publicly accessible because: Data was generated by external co-authors and will be posted on Sciencebase https://www.sciencebase.gov/catalog/item/6785551fd34ec3ce63796a66. It can be accessed through the following means: https://www.sciencebase.gov/catalog/item/6785551fd34ec3ce63796a66 in the repository for reviewers to access the data. The DOI for the final data release will be: 10.5066/P14WAHYW. Data files will be located this address. Format: FGDC metadata .xml file as well as a csv file have been included along with model results for both remote sensing at the SWAT model subbasins.
    0
    4 days ago
  • Linked remote sensing and Long Short-Term Memory (LSTM) models reveal how surface water storage dynamics influence river discharge. This dataset is not publicly accessible because: It belongs to external collaborators. It can be accessed through the following means: The DOI for the final data release will be: (https://doi.org/10.5066/P14WYWSY). Format: The data will be housed at USGS's sciencebase.gov with an FGDC metadata .xml file as well as a csv file have been included along with model results for both remote sensing at the SWAT model subbasins. A link should be included on ScienceHub that will direct users to USGS's sciencebase. The DOI for the final data release will be: (https://doi.org/10.5066/P14WYWSY)
    0
    4 days ago
  • Between December 2020 and April 2022, samples were collected at six commercial buildings in Fairbanks, Alaska and between May 2019, to June 2021 at a large, compartmentalized warehouse at a coastal site in Virginia. Types of samples collected included: indoor air; outdoor air; SSSG; soil gas; radon; differential pressure; indoor and outdoor temperature; heating, ventilation, and air conditioning (HVAC) parameters; and other environmental factors.
    2
    4 days ago
  • Data used to evaluate potential downstream impacts of the NorthMet Mine, by USEPA Office of Research and Development is providing, for USEPA Region 5’s use, including a characterization of stream specific conductivity (SC) levels, least disturbed background SC, and SC levels that may exceed the Fond du Lac Band’s WQ standards and adversely affect aquatic life, including brook trout (Salvelinus fontinalis), lake sturgeon (Acipenser fulvescens), and benthic macroinvertebrates. Keywords: Conductivity, St. Louis River, benthic invertebrates; mining The attached Excel Pedigree includes: _Datasets: Data file uploaded to EPA Science Hub and/or Environmental Data Set Gateway _R : Clean R scripts used to generate document figures and tables _Tables_Figures: Files generated from R script and used in the Region 5 memo 20220325 R Code and Data: All additional files used for this project, including original files, intermediate files, extra output files, and extra functions. The "_R" folder contains four subfolders. Each subfolder has several R scripts, input and output files, and an R project file. Users can run R scripts directly from each subfolder by installing R, RStudio, and associated R packages. Data Dictionary: See tab DataDictionary in Excel file Datasets: Simplified language is used in the text to identify parent data sets. Source and File names are retained in this pedigree in original form to enable R-scripts to retain functionality. • Thingvold et al. (1975-1977) • Griffith (1998-2009) • Predicted background (2000-2015) • Water Quality Portal (1996-2021) • Water Quality Portal Less Disturbed (1996-2021) • Minnesota Pollution Control Agency (MPCA) (1996-2013) • Mid-Atlantic Highlands (1990 to 2014). This dataset is associated with the following publication: Cormier, S., and Y. Wang. Appendix C: ORD Specific Conductance Memo, from Susan Cormier to Tera Fong. March 15, 2022. Assessment of effects of increased ion concentrations in the St. Louis River Watershed with special attention to potential mining influence and the jurisdiction of the Fond du Lac Band of Lake Superior Chippewa. U.S. Environmental Protection Agency, Washington, DC, USA, 2022.
    1
    4 days ago
  • These data include benthic invertebrate occurrence data and associated water quality data within the states of Maryland, Pennsylvania, Vermont, and West Virginia. Data are sorted into stations dominated by chloride or sulfate ions or a mix of the two. Also included are the original and curated ion mixture data, R scripts, summary plots and tables. Additional detail on methods and applications are available in these two papers: Cormier, S., L. Zheng, and C. Flaherty. A field-based model of the relationship between extirpation of salt-intolerant benthic invertebrates and background conductivity. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 633: 1629-1636, (2018). Cormier, S.M., Suter, G.W., Fernandez, M.B. and Zheng, L., 2020. Adequacy of sample size for estimating a value from field observational data. Ecotoxicology and environmental safety, 203, p.110992. This dataset is associated with the following publication: Cormier, S., T. Newcomer Johnson, and C. Wharton. Freshwater Explorer 2.0 Data and mapping capabilities and assessment examples. Presented at OWOW Webinar, Webinar, CT, USA, 06/24/2025 - 06/24/2025.
    1
    4 days ago
  • Amplicon sequence variants from benthic and zooplankton samples generated using COI and 18S primers
    3
    4 days ago
  • 4 days ago
  • These datasets provide raw stable isotope data collected as part of the National Wetland Condition Assessment (NWCA).  δ15N and δ13C measured from 10-cm Standard Depth Soil Cores are reported for 2016 NWCA.
    1
    4 days ago
  • Fecal samples from migratory birds were collected from Pb contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds. rbcL primers with Illumina adaptors: RBCL-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGYGATGGACTTACNAGTCTTGATCGTTACAAAGG RBCL-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGNCCATAYTTRTTCAATTTATCTCTTTCAACTTGGATNCC Also, mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected, which can be found at DOI: 10.23719/1532394
    2
    4 days ago
  • Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393
    2
    4 days ago
  • Raw underlying data for visualizations in the main body of the manuscript. This dataset is associated with the following publication: Champion, W., M. MacDonald, B. Thomas, S. Bantupalli, and E. Thoma. Methane sensor characterization using colocated ambient comparisons and simulated emission challenges. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 0, (2025).
    1
    4 days ago
  • The dataset is comprised of: 1)VOC concentrations of soil gas and indoor air samples collected over the site; 2) the pressure readings used to monitor the pressure differential between subslab and indoor air.
    1
    4 days ago
  • Data describes Satellite-derived monthly averaged PM2.5 concentrations for South America and Asunción during February 2020, Box-and-whisker plots showing the distributions of monthly mean PM2.5 values and 24-hr PM2.5 mean values for each ground-level sensor, Line graph showing hourly PM2.5 averages for each grou, nd-level sensor, Sensor-measured daily PM2.5 means for ItaEnramada and Villamora during August 2020 (fire season) and March 2021 (rainy season). This dataset is not publicly accessible because: Owned by Chester F. Carlson Center for Imaging Science at the Rochester Institute of Technology. It can be accessed through the following means: Contact John Kerekes at kerekes@cis.rit.edu. Format: Medium sized files; not too big. No special equipment needed. This dataset is associated with the following publication: Baldauf, R., L. Prox, J. Kerekes, Y. Zhou, G. Pallarolas , and M. Lang. Integrating satellite and sensor measurements to understand urban air quality: case study of PM2.5 in Asunción, Paraguay. EM: AIR AND WASTE MANAGEMENT ASSOCIATION'S MAGAZINE FOR ENVIRONMENTAL MANAGERS. Air & Waste Management Association, Pittsburgh, PA, USA, NA, (2023).
    0
    4 days ago
  • This dataset includes vehicle emission rates and test run data used to generate the figures and tables used in the manuscript. A data dictionary describes each parameter and provides their units. On-road tailpipe emission measurements were collected by EPA in 2015 to examine differing emission rates from light-duty trucks under towing and non-towing conditions, and to compare measured emission rates to MOVES modeled estimates. This dataset is associated with the following publication: Kim, B., R. Jaikumar, R. Souza, M. Xu, J. Johnson, C. Fulper, J. Faircloth, M. Venugopal, C. Gu, T. Ramani, M. Aldridge, R. Baldauf, A. Fernandez, T. Long, R. Snow, C. Williams, R. Logan, and H. Vreeland. Emission Rates for Light-Duty Trucks Based on Towing Operations in Real-World Conditions. ATMOSPHERE. MDPI, Basel, SWITZERLAND, 0, (2025).
    1
    4 days ago
  • Data describes the influence of vegetation growth on the barrier’s physical dispersion mechanisms, spatial decay of pollutant concentration at various growth stages, the influence of vegetation growth on the reduction of particles and tracer gas at extreme wind speeds, the Impact of vegetation growth on average concentration for various wind speeds and particle sizes, and the Influence of LAI, vegetation species, and LAD profile on pollutant reduction. This dataset is not publicly accessible because: Data belongs to Sibley School of Mechanical and Aerospace Engineering, Cornell University, Ithaca, NY 14853, USA. It can be accessed through the following means: Contact K. Max Zhang at kz33@cornell.edu. Format: Medium sized format; no special equipment needed. This dataset is associated with the following publication: Hashad, K., B. Yang, J. Gallagher, R. Baldauf, P. Deshmukh, and M. Zhang. Impact of roadside conifers vegetation growth on air pollution mitigation. LANDSCAPE AND URBAN PLANNING. Elsevier Science Ltd, New York, NY, USA, 229: 0, (2023).
    0
    4 days ago
  • This dataset includes CMAQ model code and a description/location of meteorological files. Portions of this dataset are inaccessible because: Non-EPA-owned by Alaska Department of Environmental Conservation. They can be accessed through the following means: Contact Deanna Huff from AK DEC at deanna.huff@alaska.gov (907-465-5116). Format: Netcdf files containing CMAQ inputs (emissions, initial/boundary conditions) and outputs (> 600 GB), excel spreadsheets with emissions information and post-processing calculations. This dataset is associated with the following publication: Huff, D., T. Carlson, L.P. Vennam, C. Chien, K. Fahey, R. Gilliam, and N. Czarnecki. Modeling attainment in Fairbanks, Alaska for the wintertime PM2.5 24-hour non-attainment area using the CMAQ (community multi-scale air quality) model. Faraday Discuss. Royal Society of Chemistry, Cambridge, UK, 258: 234-264, (2025).
    4
    4 days ago
  • Brainstem Auditory Evoked Potential, Peripheral Nerve Action Potentials/NCV, Somatosensory Evoked Potentials (Cortex, Cerebellum) from adult male Long-Evans rats developmentally exposed to emamectin.
    1
    4 days ago
  • This dataset includes data for the manuscript in progress, Intracerebroventricular kynurenic acid modulation differentially regulates the immune and neuroendocrine stress response to acute ozone exposure. This study employed the use of kynurenic acid or the kynurenic acid synthesis inhibitor, PF-04859989 infused into the dorsal third ventricle of the brain in male WKY rats, prior to acute ozone exposure at 0.8 ppm, to evaluate the role of kynurenic acid in modulating the neuroendocrine stress response to ozone. Our results indicate that kynurenic acid may have a protective role in the brain, in attenuating the pulmonary and systemic effects of ozone exposure, perhaps through multiple mechanisms. This dataset is associated with the following publication: Rentschler, K., M.C. Schladweiler, R. Grindstaff, W. Williams, P.R. Kodavanti, D. Freeborn, L. Klein, G. Jung, D. Herr, P. Evansky, J. McKee, S. Gavett, and U. Kodavanti. Differential Effects of Intracerebroventricular Kynurenic Acid Regulation on the Inflammatory and Neuroendocrine Response to Acute Ozone Exposure. Presented at Society of Toxicology, Orlando, FL, USA, 03/16/2025 - 03/20/2025.
    1
    4 days ago
  • the data include results of PFAS concentration in primary and secondary landfill leachate. Each figure in the manuscript has a specific sheet associated with it. This dataset is associated with the following publication: Robey, N., Y. Liu, T. Tolaymat, J. Bowden, H. Solo-Gabriele, and T. Townsend. Per- and Polyfluoroalkyl Substances (PFAS) Profiles in Primary and Secondary Landfill Leachates: Indications of Transformation, Liner Interactions, and other PFAS Sources. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 494: 138705, (2025).
    1
    4 days ago
  • We used systematic evidence map methods to summarize the available epidemiological and animal bioassay evidence for an expanded set of ~15,000 PFAS that were identified as PFAS by EPA's Center for Computational Toxicology and Exposure (CCTE). This work is a continuation of our previous 2022 and 2024 SEMs that inventoried evidence on a separate set of ~500 PFAS (Carlson et al, 2022, https://doi.org/10.1289/EHP10343; Radke et al, 2022, https://doi.org/10.1289/EHP11185; Carlson et al., 2024; https://doi.org/10.1289/EHP14191) and a 2023 evidence map on an additional 345 PFAS (Shirke et al. 2024, https://doi.org/10.1289/EHP13423 ). The comprehensive PFAS dashboard includes evidence identified from our past SEMs and completed US EPA assessments. This dataset is associated with the following publication: Shirke, A., E. Radke, R. Jones, B. Allen, C. Lin, A. Ross, N. Vetter, C. Lemeris, p. hartman, S. Eftim, A. Varghese, R. Blain, H. Hubbard, A. Williams, K. Thayer, and L. Carlson. Systematic Evidence Map for the Per- and Polyfluoroalkyl Substances (PFAS) Universe. ENVIRONMENTAL HEALTH PERSPECTIVES. National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC, USA, 0(0): 1-45, (2025).
    6
    4 days ago
  • EPA, in collaboration with NASA, collected upward-viewing UV/visible solar radiance measurements at air quality stations in the New York City region. From these radiances, NO2 vertical column densities (molecules cm-2) are retrieved for comparison to retrieved NO2 column from a downward viewing, satellite-based UV/visible instrument, the NOAA Ozone Mapping and Profiler Suite (OMPS) . This dataset is associated with the following publication: Huang, X., K. Yang, S. Kondragunta, Z. Weir, L. Valin, J. Szykman, and M. Goldberg. NO2 retrievals from NOAA-20 OMPS: Algorithm, evaluation, and observations of drastic changes during COVID-19. ATMOSPHERIC ENVIRONMENT. Elsevier B.V., Amsterdam, NETHERLANDS, 290: 119367, (2022).
    1
    4 days ago
  • This data set includes data quantifying streamflow at gauging stations in the Long Island Sound watershed and nearby watersheds for 2003 to 2016, characteristics of the watersheds draining to the gauging stations, and simulation results from global climate models. The data also includes Matlab and R code used to generate predicted changes in stream flow as described in the paper. This dataset is associated with the following publication: Duvall, M., and J. Hagy. Climate-induced changes in streamflow and nitrogen loading to Long Island Sound. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 992: 179957, (2025).
    1
    4 days ago
  • Human health and air quality impact factors can be used to endogenize impacts into a human-Earth systems model such as the state-level Global Change Analysis Model (GCAM-USA). The resulting model can then be used to evaluate the monetized health or air quality benefits associated with a technology or policy. Endogenized air pollution impacts can also be constrained, allowing GCAM-USA to identify cost-effective strategies for achieving targeted goals. This package includes R code for developing health impact values ($/ton) and a spreadsheet for translating those factors into damage factors ($/unit activity). Resulting comma-separated-value files that include health damage factors for ozone and particulate matter are also included.
    1
    4 days ago
  • This dataset provides the scenario output data assessed in the following publication: Understanding Uncertainty in Market-Mediated Responses to US Oilseed Biodiesel Demand: Sensitivity of ILUC Emission Estimates to GLOBIOM Parametric Uncertainty Neus Escobar, Hugo Valin, Stefan Frank, Diana Galperin, Christopher M. Wade, Leopold Ringwald, Daniel Tanner, Niklas Hinkel, Petr Havlík, Justin S. Baker, Sharyn Lie, and Christopher Ramig Environmental Science & Technology 2025 59 (1), 302-314 DOI: 10.1021/acs.est.3c09944 Data included consist of 1. outputs for a central baseline scenario and policy shock which mandates an additional 1 billion gallons of soybean oil biodiesel consumption within the USA 2. calculated scenario differences for each trial under a one-at-a-time sensitivity analysis 3. calculated scenario differences for each trial under a Monte-carlo sensitivity analysis 4. calculated results from a Bayesian Additive Regression Trees (BART) analysis. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • Our research used a combination of laboratory-based acute aqueous metals exposures and RNA-sequencing technologies to identify a gene-based means to extrapolate metals toxicity across a range of fish taxa. For Phase 1 of our project, we compared transcriptome changes in caudal fin, gill and liver of juvenile Rainbow trout (Oncorhynchus mykiss) exposed to cadmium (Cd), copper (Cu), or zinc (Zn) at 17, or 50% of LC50 concentrations for 24 and 96 hours to controls. These experiments allowed us to test for conserved responses to the metal exposures, and to test which metal produced the most coherent gene expression profile indicative of a defined mode of action. During Phase 2, we exposed juvenile Chinook salmon (Oncorhynchus tshawytscha) to the selected metal (Zn) to begin to ascertain the extent to which the mode of action identified was conserved among salmonids.
    2
    4 days ago
  • This dataset contains long term dendrometer, meteorological, and soil measurements collected in Oregon's Cascades and Coast ranges.
    4
    4 days ago
  • CMAQ v5.5 Annual 2023 Gridded Predictions Across the US and Canada Data contact: Havala Pye, ORCID: 0000-0002-2014-2140 This dataset provides daily predictions of ozone and fine particle (PM2.5) species across the contiguous U.S. and a large fraction of Canada at 12km horizontal resolution for 2023. Values are predicted by CMAQv5.5 with CRACMM chemistry. Please see Pye, H. O. T. (2025). CMAQ v5.5 Annual 2023 Gridded Predictions Across the US and Canada (v1.0) [Data set]. Zenodo. https://doi.org/10.5281/zenodo.15732714 for the full archive. Please cite the following for CMAQ with CRACMM2: Skipper, T. N., D'Ambro, E. L., Wiser, F. C., McNeill, V. F., Schwantes, R. H., Henderson, B. H., Piletic, I. R., Baublitz, C. B., Bash, J. O., Whitehill, A. R., Valin, L. C., Mouat, A. P., Kaiser, J., Wolfe, G. M., St. Clair, J. M., Hanisco, T. F., Fried, A., Place, B. K., and Pye, H. O. T.: Role of chemical production and depositional losses on formaldehyde in the Community Regional Atmospheric Chemistry Multiphase Mechanism (CRACMM), Atmos. Chem. Phys., 24, 12903–12924, https://doi.org/10.5194/acp-24-12903-2024, 2024. DISCLAIMER: This data product has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for public release. At the time of release, the data had not yet been published in peer-reviewed literature. The data is provided for research and the user should verify the data is suitable for their intended use.
    4
    4 days ago
  • Mitchell, M.E., Anteau, M.J., Pearse, A.T. et al. Modeling Wetland Resources for Spring Migratory Waterbirds Under Different Agricultural Management Scenarios in the Iowa Portion of the Prairie Pothole Region, USA. Wetlands 45, 48 (2025). https://doi.org/10.1007/s13157-025-01930-y. This dataset is associated with the following publication: Mitchell, M., M. Anteau, A. Pearse, T. Newcomer-Johnson, J. Christensen, W. Crumpton, B. Dyson, T. Canfield, M. Helmers, D. Green, and K. Forshay. Modeling Wetland Resources for Spring Migratory Waterbirds Under Different Agricultural Management Scenarios in the Iowa Portion of the Prairie Pothole Region, USA. WETLANDS. The Society of Wetland Scientists, McLean, VA, USA, 45: article number 48, (2025).
    3
    4 days ago
  • A workbook of all the soils data collected near Holton, Kansas, in agricultural fields. Laboratory analysis of soil properties was completed by Ward Labs in Kearny Nebraska. Isotope analysis of soils was completed in Integrated Stable Isotope Research Facility operated by US Environmental Protection Agency. The goal of this project was to evaluate if Soil Health Principles can reduce the risk of nitrate leaching from agricultural fields. This effort was a collaborative project between EPA Region 7, EPA Office of Research and Development, and Kansas Department of Health and Environment (KDHE). Discussion of the project generating these data is available on the KDHE website: https://storymaps.arcgis.com/stories/1efcfe1924fc4daf85a7958c0a41fa5a It can also be found on the KDHE Watershed Management Section at the end of the What we Do section. https://www.kdhe.ks.gov/974/Watershed-Management-Section
    1
    4 days ago
  • Data is available from Philip T. Gidley (philip.t.gidley@erdc.dren.mil), Environmental Laboratory, ERDC, US Army Corps of Engineers, Vicksburg, MS, USA. This dataset is not publicly accessible because: Non-EPA-owned by U.S. Army Corps of Engineers (Environmental Laboratory, ERDC, Vicksburg, MS). It can be accessed through the following means: Contact Philip T. Gidley (philip.t.gidley@erdc.dren.mil), Environmental Laboratory, ERDC, US Army Corps of Engineers, Vicksburg, MS, USA. Format: Excel spreadsheets. This dataset is associated with the following publication: Gidley, P.T., G.R. Lotufo, A.J. Kennedy, N.L. Melby, A.H. Wooley, C.H. Laber, R.M. Burgess, C.E. Ruiz, and T.S. Bridges. Effect of Activated Carbon in Thin Sand Caps Challenged with Ongoing PCB Inputs from Sediment Deposition: PCB Uptake in Clams (Mercenaria mercenaria) and Passive Samplers. ARCHIVES OF ENVIRONMENTAL CONTAMINATION AND TOXICOLOGY. Springer, New York, NY, USA, 82: 95-104, (2022).
    0
    4 days ago
  • Excess sediments and anthropogenic nutrients, especially nitrogen (N) and phosphorous (P), are leading cause of water quality impairment in streams and wetlands throughout the Mid-Atlantic Region of the US. Legacy sediments, deposited as a function of historic mill dam construction, may contribute significantly to the sediment and nutrient load of streams and waterways. In addition, the accumulation of legacy sediments in valley bottoms has buried extensive Holocene wetlands, and substantially altered the hydrology of entire watersheds. This data contains water quality measurements collected before and after sediment restoration at Big Spring Run in Pennsylvania.
    2
    4 days ago
  • With increasing concerns about freshwater cyanobacteria blooms, there is a need to identify which waterbodies are at risk for developing these blooms, especially those that produce cyanotoxins. To address this concern, we developed spatial statistical models using the US National Lakes Assessment, a survey with over 3,000 spring and summer observations of cyanobacteria abundance and microcystin concentration in lakes across the conterminous US. We combined these observations with other nationally available data to model which lake and watershed factors best explain the presence of harmful cyanobacterial blooms. We then used these models to estimate the cyanobacteria abundance and probability of microcystin detection in 124,500 lakes across the CONUS. This dataset includes the compiled data used to generate the models and the dataset used to generate prediction for a much larger population of lakes. The data package includes two tabular data files, two tabular metadata files, and one methods document.
    4
    4 days ago
  • Summary statistics for PFAS measured in tap water, glass slab wipes, and house dust. Associated method and QC information. This dataset is associated with the following publication: Chang, N., C. Eichler, E. Cohen-Hubal, J.D.S. Jason D. Surratt, G. Morrison, and B. Turpin. Exposure to Per- and Polyfluoroalkyl Substances (PFAS) in North Carolina Homes: Results from the Indoor PFAS Assessment (IPA) Campaign. Environmental Science: Processes & Impacts. Royal Society of Chemistry, Cambridge, UK, 27(6): 1654-1670, (2025).
    1
    4 days ago
  • A Yellow Springs Inc. (YSI) multiparameter water quality datasonde (model numbers 6600 EDS, 6600 V2-4 or EXO2) was deployed off the Oregon State University (OSU) pump house dock or OSU Ship Ops dock at the following UTM, Zone 10 North coordinates: 4941737.6 North, 417258.8 East; 4941885.9 North, 417087.8 East, respectively. Temperature, salinity, depth, pH, dissolved oxygen, fluorescence, and turbidity data were collected from 22 January 2009 to 2 April 2025. The YSI sondes were replaced approximately monthly with newly calibrated instruments (calibrated following standard operating procedures) and were deployed at a fixed depth off the bottom. Upon retrieval, the sondes were returned to the laboratory where their performance was checked. A series of custom R scripts were used to post-process all data files. On the “ReadMe” tab is information which includes sonde model used through the deployment period, deployment depth (sonde height off the bottom), and comments related to specific deployment issues.
    1
    4 days ago
  • This dataset is comprised of survey responses from EPA staff regarding environmental cleanup activities. The survey asked participants about strategies EPA cleanup personnel use to get to know communities, build trust, and build stakeholder relationships. It also contains questions related to the respondent’s employment status and history with the EPA, their current role in environmental cleanup, and the type of cleanup, cleanup site, and contaminants with which they most commonly work.
    2
    4 days ago
  • These files contain gridded annual dry deposition estimates from 2002 to 2019 from the Environmental Protection Agency’s Community Multiscale Air Quality (CMAQ) model version 5.3.2 (see https://github.com/USEPA/CMAQ/tree/5.3.2) with the revised Surface Tiled Aerosol and Gaseous Exchange (STAGE) model (Appel et al., 2021) created for the EPA’s Air QUAlity TimE Series (EQUATES, https://www.epa.gov/cmaq/equates) project. These deposition fields have been downscaled from the native 12 km resolution to 300 m by mapping STAGE land use specific deposition to Moderate Resolution Imaging Spectrometer (MODIS) 17 category International Geosphere-Biosphere Programme (IGBP) classification scheme. For details on model inputs, please refer to the EPA’s EQUATES (https://www.epa.gov/cmaq/equates) project and Benish et al., 2022.
    1
    4 days ago
  • The City-based Optimization Model for Energy Technologies (COMET-NYC) is an energy system modeling tool developed by the U.S. Environmental Protection Agency. COMET is applied to New York City to support long-term, metropolitan-scale air, climate, and energy planning. Built on the internationally recognized TIMES modeling framework, COMET-NYC identifies the least-cost mix of technologies and fuels required to meet projected energy demands from 2010 to 2055 across NYC’s buildings, transportation, and electricity sectors. COMET-NYC uses a scenario-based optimization approach to simulate the deployment of energy technologies under various assumptions, policies, and constraints. It incorporates local data sources to estimate and calibrate energy consumption and emissions at the borough level. It tracks both greenhouse gases (GHGs) and criteria air pollutants, supporting city-level climate and air quality policy evaluation. The model includes detailed modules for the residential, commercial, industrial, and transportation sectors, accounting for current and future technology costs, fuel types, and efficiency parameters. It uses linear programming to minimize system-wide costs while meeting energy service demands and emissions targets. COMET-NYC supports both retrospective analysis (e.g., calibration to 2010, 2015, and 2020) and future scenario exploration, such as electrification strategies. Two versions of the model are included in this dataset: v15.0.9, which underpinned emissions reduction planning during the 2023–2024 NYC budgeting cycle, and v16.0.1, which includes updated buildings data and improved calibration. The documentation included various appendices for background data to build COMET-NYC. Appendix A through F are included in this dataset. Appendix A provides time slice documentation; Appendix B provides PLUTO 2010 data; Appendix C provides original 2014 building end-use demand splits for NYC; Appendix D provides EIA 2023 building technology data; APPENDIX E provides 2015 NYMTC SEDS population and employment forecasts; and APPENDIX F provides Documentation of Transportation Sector Emission Factors Updates and related input datasets for MOVES model. This dataset is associated with the following publication: Kaplan, O., Z. Carroll, M. Pied, R. Chaffanjon, and K. Vaillancourt. Documentation for application of City-based Optimization Model for Energy Technologies (COMET) to New York City to support metropolitan-scale air, climate, and energy planning. U.S. Environmental Protection Agency, Washington, DC, USA, 2025.
    12
    4 days ago
  • Summary statistics of indoor and outdoor collected ionic PFAS where values have been mean field blank subtracted. n.d. indicates non-detect and values with a “<” in front indicate that that PFAS was detected but at concentrations below the MDL. Concentrations below the MDL were not adjusted. This dataset is associated with the following publication: Chang, N., C. Eichler, D. Amparo, J. Zhou, K. Baumann, E. Cohen-Hubal, J. Surratt, G. Morrison, and B. Turpin. Indoor air concentrations of PM2.5 quartz fiber filter-collected ionic PFAS and emissions to outdoor air: findings from the IPA campaign. Environmental Science: Processes & Impacts. Royal Society of Chemistry, Cambridge, UK, 27(6): 1603-1618, (2025).
    1
    4 days ago
  • the dataset includes: 1. EPIC_outputs are EPIC yearly output files from Rainfed/Irrigated corn grain simulations using 2006/2011 fertilizer management scenario for the simulation periods of 2002 to 2009 and 2010 to 2017 (e.g. CornGrainIrrig-2006FMS_yrs2002-09.csv: yearly output from 2002 to 2009 for Irrigated Corn grain using 2006 fertilizer management scenario; CornGrainRainfed-2011FMS_yrs2010-2017.csv: yearly output from 2010 to 2017 for Rainfed Corn grain using 2011 fertilizer management scenario); 2. \EPIC_outputsAggregated are saved average annual EPIC output aggregated over entire CONUS or GRIDCELL used for GIS maps including Figures 4, 5 and 9 (e.g. CONUS_2006FMS_AvgOf2003-2009.csv: average annual EPIC output using 2006 fertilizer management scenario for period from 2003 to 2009 and aggregated over CONUS CONUS_GRIDCELL_2006FMS_AvgOf2003-2009.csv: average annual EPIC output using 2006 fertilizer management scenario for period from 2003 to 2009 and aggregated over each CONUS GRIDCELL); 3.\SummaryData_FromEPIC_for_Tables_Figs are saved summarized data for all the tables and Figs in Excel sheets. This dataset is associated with the following publication: Wang, X., Y. Yuan, V. Benson, and L. Ran. An Integrated Multi-Media Modeling System for Regional- to National-Scale Nitrogen and Crop Productivity Assessments. Agriculture. MDPI, Basel, SWITZERLAND, 15(10): 1017, (2025).
    1
    4 days ago
  • Dataset summarizes the results of a study to examine de facto reuse of contaminants of emerging concern
    1
    4 days ago
  • Dataset for Jesse Rogers et al., 'Integrating Transcriptomic and Targeted New Approach Methodologies into a Tiered Framework for Chemical Bioactivity Screening' published in Environmental Health Perspectives, Vol 133, Issue 6, 067013, June 2025. DOI: https://doi.org/10.1289/EHP16024, PMC12165737 R scripts for reproducing all analyses are available on Github (https://github.com/USEPA/CompTox-HTTr-RCAS). All sequencing data are available via the Gene Expression Omnibus repository (accessionnumbers GSE274318 for U-2 OS and GSE284321 for HepaRG). High-throughput screening assay data are available from InvitroDB via download 29 or the USEPA CompTox Chemicals Dashboard(https://comptox.epa.gov/dashboard/). This dataset is associated with the following publication: Rogers, J., J. Bundy, J. Harrill, R. Judson, K. Friedman, and L. Everett. Integrating Transcriptomic and Targeted New Approach Methodologies into a Tiered Framework for Chemical Bioactivity Screening. ENVIRONMENTAL HEALTH PERSPECTIVES. National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC, USA, 133(6): 067013, (2025).
    3
    4 days ago
  • Soil health data. This dataset is not publicly accessible because: Owned by primary author. It can be accessed through the following means: Contact primary author. Format: Data is excel spreadsheets. This dataset is associated with the following publication: Umeobi, E., T. Ducey, M. Johnson, and J. Ippolito. Soil health alterations with compost additions to natural and remediated heavy metal-contaminated mineland soils. ENVIRONMENTAL SCIENCE AND POLLUTION RESEARCH. Ecomed Verlagsgesellschaft AG, Landsberg, GERMANY, s11356-025-36602-1, (2025).
    0
    4 days ago
  • The United States Environmental Protection Agency (US EPA) conducts extensive research to enhance the scientific foundation for national environmental decision-making. In this context, US EPA has developed COMET (City-based Optimization Model for Energy Technologies) to capture the whole energy system at the city level over a user-defined analyses timeline, from the extraction of primary resources to conversion into useful energy to meet end-use service demands. COMET accounts for the investment and operation costs, as well as greenhouse gas (GHG) emissions and other air pollutants, of alternative technology pathways meeting long-term energy demands in the buildings, transportation, and waste sectors. In this way, COMET enables users to explore, compare, and optimize energy technology solutions over the coming decades, especially for medium- and large-sized cities working to achieve energy optimization objectives and emissions reduction targets. Model results reveal how the energy system can be balanced under different scenarios and assumptions, as well as how system costs and emissions change with respect to those scenarios. With this information, city officials and their stakeholders working to pursue energy planning within their borders are positioned to make more informed policy and program decisions. An open-source version of COMET designed for use by local planning, energy, or environmental agencies in any city is developed – will be called “Generative COMET”. The Generative COMET model incorporates innovative features that streamline the calibration process to align with official energy or GHG inventories, based on the level of detail available in city-level data. It provides cities with a versatile framework for analyzing energy and GHG emission scenarios, with different levels of data granularity and city-specific conditions. Its modular and adaptable structure enables cities of all sizes to explore customized strategies for meeting energy demands and achieving GHG reduction targets effectively. This dataset is associated with the following publication: Kaplan, O., K. Vaillancourt, M. Pied, R. Chaffanjon, F. Pedroli, D. Cooley, and N. Dietsch. Generative City-based Optimization Model for Energy Technologies: COMET Documentation and User Guide. U.S. Environmental Protection Agency, Washington, DC, USA, 2025.
    2
    4 days ago
  • The dataset summarizes the results of sampling campaigns at the Massachusetts Alternative Septic System Technology Center.
    1
    4 days ago
  • This dataset summarizes the concentrations of chemicals in the influent and effluent of six ndividual onsite septic systems as well as two decentralized systems.
    1
    4 days ago
  • Non-EPA data associated with Air Quality, Health, and Equity Benefits of Carbon Neutrality andClean Air Pathways in China. This dataset is not publicly accessible because: Data owned by Tsinghua University. It can be accessed through the following means: Contact Shuxiao Wang of Tsinghua University (shxwang@mail.tsinghua.edu.cn). Format: GCAM database, tables, and files associated with air quality simulations. This dataset is associated with the following publication: Sun, Y., Y. Jiang, J. Xing, Y. Ou, S. Wang, D. Loughlin, S. Yu, L. Ren, S. Li, Z. Dong, H. Zheng, B. Zhao, D. Ding, F. Zhang, H. Zhang, Q. Song, K. Liu, Z. Klimont, J. Woo, X. Lu, S. Li, and J. Hao. Air Quality, Health, and Equity Benefits of Carbon Neutrality and Clean Air Pathways in China. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 58(34): 15027-15037, (2024).
    0
    4 days ago
  • Data used to generate Figures 1-3 and Table 2 in the journal article entitled "Evaluating the Laboratory Performance of Pellet-Fueled Semigasifier Cookstoves" https://doi.org/10.1021/acs.est.4c10008 Figure 1. Box and whisker plots (with jittered points by ISO test phase) of emission factors based on energy delivered (EFd) for particle pollutants (a) fine particulate matter (PM2.5), (b) ultrafine particles (UFP), (c) organic carbon (OC), and (d) elemental carbon (EC). Figure 2. Box and whisker plots (with jittered points by the ISO test phase) of emission factors based on energy delivered (EFd) for gaseous pollutants: (a) carbon monoxide (CO), (b) total hydrocarbons (THC), (c) methane (CH4), and (d) nitrogen oxides (NOx). Figure 3. Emission factors (based on energy delivered) of fine particulate matter (PM2.5) and carbon monoxide (CO) plotted against ISO Tiers for distinct test phases (i.e., power levels) and overall (i.e., mean of phase-averaged) results for all three stoves (a−c). Error bars represent the 90% confidence intervals in the mean. Mean values are also plotted from the literature (d) for lab (L), test kitchen (K), and field (F) studies, as summarized in Tables S16 and S17. Table 1. Summary of Power Level Mean (i.e., Mean of All Stove/Fuel Combinations at a Given Power Level) and Standard Deviations (SD, Here Defined as Standard Deviations of All Stove/Fuel Combination Means at a Given Power Level) of Emission Factors Based on Energy Delivered (EFd) for All Pollutants Excluding Carbon Dioxide (CO2). This dataset is associated with the following publication: Champion, W., G. Shen, C. Williams, L. Virtaranta, M. Barnes, C. Christianson, M. Hays, and J. Jetter. Evaluating the Laboratory Performance of Pellet-fueled Semi-gasifier Cookstoves. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 59(4): 0, (2025).
    1
    4 days ago
  • The purpose of this dataset was to compile, in a single location, the landfilled solid waste quantity data from various state government reports, repositories, or databases. The development of the dataset has several motivating factors, including to understand the amounts and types of wastes that are disposed in non-hazardous waste landfills and to understand the availability of these types of data across our United States. This dataset only contains tonnages (i.e., weights or masses in U.S. tons) of disposed materials/wastes in as much detail as the State provides. It does not include amounts of wastes recycled, composted, incinerated, transferred, or generated. For instance, a landfill may receive ash that comes from the incineration of municipal solid waste (MSW; e.g., waste-to-energy ash). The amount of incinerated ash that is landfilled would be reported here but not the amount of waste the incinerator received.
    1
    4 days ago
  • Methods S1–S2 detailing laboratory and data analysis methods; tables describing materials used (Table S1), assay wells excluded from analyses (Table S2), sourcing information for test chemicals (Table S3), cell culture media (Table S4) and assay reagents (Table S5), and descriptions and metadata for data files S1–S9 (PDF) File S1 containing the 2D chemical structures for all antiozonant compounds tested in this study (PDF) File S2 containing the list of features used for profile correlation analysis (XLSX) File S3 containing graphs of each cell viability and Cell Painting concentration–response curve for all tested chemicals in the study (PDF) File S4 containing the curve-fitting results for the cell viability assay (XLSX) File S5 containing the curve-fitting results for the Cell Painting assay (XLSX) File S6 containing a list of all features collected during Cell Painting and their metadata (XLSX) File S7 containing the normalized well-level values for the Cell Painting assay (XLSX) File S8 containing global Mahalanobis distance values for the Cell Painting assay, 1 per well (XLSX) File S9 containing category Mahalanobis distance values for the Cell Painting assay, 49 per well (XLSX). This dataset is associated with the following publication: Harris, F., M. Jankowski, D. Villeneuve, and J. Harrill. Phenotypic Profiling of 6PPD, 6PPD-quinone and Structurally Diverse Antiozonants in RTgill-W1 Cells Using the Cell Painting Assay. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 12(6): 695-701, (2025).
    10
    4 days ago
  • Three chemicals, 2-ethylhexyl 4-hydroxybenzoate (2-EHHB), 5-chloro-2-(2,4-dichlorophenoxy) phenol (triclosan), and 4-nonylphenol, branched (4-NP) were evaluated using the Larval Amphibian Growth and Development Assay (LAGDA) to investigate endocrine-mediated effects. A delay in development to NF stage 62 was observed for the three chemicals, however, histopathological evaluation revealed that the effects were likely not thyroid related. 4-NP caused increased stage scores in male and female gonadal duct development. Citation information for this dataset can be found in Data.gov's References section.
    3
    4 days ago
  • Dataset for S. Sakamuru, et al., 'Profiling the Tox21 Compound Library for Their Inhibitory Effects on Cytochrome P450 Enzymes' published in Int'l Journal of Molecular Sciences, DOI https://doi.org/10.3390/ijms26114976 The screening data are available at https://tripod.nih.gov/pubdata/ and in PubChem at https://pubchem.ncbi.nlm.nih.gov/ (PubChem Assay IDs for CYP assays are 1671199, 1671198, 1671197, 1671196, and 1671201 and for Luciferase assay is 1224835).
    1
    4 days ago
  • The database Estuarine Habitat Project contains tables holding information on fyke net and trawl sampling done in the Yaquina, Oregon estuary during 2008 to 2011.
    2
    4 days ago
  • The accompanying database contains the data associated with an EPA funded study of the effects of offshore dredge spoil disposal. Sites offshore of Oregon’s Yaquina Bay were sampled using benthic box-core samplers. Species present in the samples were identified and enumerated.
    2
    4 days ago
  • A link to Water stable isotopes for streams and precipitation samples in the HJ Andrews Experimental Forest, 2014-2023 https://doi.org/10.6073/pasta/f7bfbab3132ac23002d5df6e837a9d0e
    1
    4 days ago
  • daily time series of VMT reduction ratios from the INRIX Analytics big data assessment platform (https://inrix.com/covid-19-transportation-trends). This dataset is not publicly accessible because: Please contact Dr. Saravanan Arunachalam from UNC IE for more information. It can be accessed through the following means: Please contact Dr. Saravanan Arunachalam from UNC IE for more information. Format: Please contact Dr. Saravanan Arunachalam from UNC IE for more information. This dataset is associated with the following publication: Arter, C., J. Buonocore, V. Isakov, G. Pandey, and S. Arunachalam. Air pollution benefits from reduced on-road activity due to COVID-19 in the U.S.. PNAS Nexus. Oxford University Press, OXFORD, UK, 3(1): pgae017, (2024).
    0
    4 days ago
  • Dorsal third ventricle infusions of the alpha 2 adrenergic receptor antagonist, mianserin- which increases brain concentrations of dopamine, serotonin, and acetylcholine, or the glucocorticoid receptor antagonist, mifepristone, were performed in male WKY rats prior to acute ozone exposure at 0.8 ppm for 4 hours. This experiment was designed to target hippocampal and hypothalamic neuromodulation to determine the role of indoleamines, monoamines, and glucocorticoids in mediating the systemic and pulmonary effects to ozone exposure.
    1
    4 days ago
  • Dispersion effectiveness data for petroleum oils in low and hypersaline waters. Chemical dispersant formulations typically provide maximum oil dispersion in waters between 30-40 ppt (parts per thousand) salt content, which encompasses typical 35 ppt ocean salinity. Ocean salinity can vary locally, from very low values due to freshwater river inflows or ice melt, to extremely high values during freeze up periods or within natural brine pools. In this study, the influence of salinity (0.2-125 ppt) on dispersion effectiveness (DE) was evaluated for three oils and four dispersants using the baffled flask test (BFT) and oil droplet size distribution (DSD) measures. Tank-scale dispersions support the laboratory-scale results of DSD. Light and medium crude oils were effectively dispersed over a wide salinity range using the BFT. However, dispersions exhibiting similar DE values possessed a wide range in DSD metrics, suggesting that the latter offers useful information for spill planning and understanding the transport and fate of spilled oil. This dataset is associated with the following publication: Conmy, R., D. Sundaravadivelu, B. Schaeffer, B. Robinson, T. King, and R. Grosser. Dispersion Effectiveness of Petroleum Oils in Low and Hypersaline Waters. MARINE POLLUTION BULLETIN. Elsevier Science Ltd, New York, NY, USA, 215: 117913, (2025).
    1
    4 days ago
  • Healthy seagrass beds were once found throughout the shallow areas of Narragansett Bay, R.I. but have largely disappeared due to infilling, nutrient pollution, and disease. In Greenwich Bay, a highly developed embayment within Narragansett Bay, the widgeon grass, Ruppia maritima, has colonized an area on the northern shore once dominated by the eelgrass, Zostera marina. This area is sandy, which may allow groundwater seepage. This observation is consistent with our understanding of Ruppia ecology. This genus is extremely salinity tolerant and may be more nutrient tolerant than Zostera. To experimentally explore this phenomena, two, 6-week microcosm experiments were conducted. For both experiments, shoots of sub-aquatic vegetation (SAV; Ruppia or Zostera) were planted in sediment in 10 cm plastic tubes. These tubes were placed in large flow-through water tanks outside on a dock to keep temperature consistent. experiments, shoots of SAV were planted in sediment in 10 cm plastic tubes. These tubes were placed in large flow-through water tanks outside on a dock to keep temperature consistent.
    1
    4 days ago
  • Unlike many estuaries, Narragansett Bay nutrient inputs are dominated by point sources. After a large fish kill in 2003, large management actions have been implemented to reduce nitrogen loads to 5 mg/l by implementing fixed film activated sludge treatment (on-line 2013 and 2014) and preventing combined sewage overflow by creating large interceptor tunnels (2008 = phase 1, 2014 = phase 2). These data were collected to assess conditions after these major management upgrades had been implemented. With previously published data, it may be possible to assess change before, during and after sewage treatment upgrades.
    1
    4 days ago
  • This collection includes input and output data files from a SWAT model calibrated for the Upper Rogue River, OR, USA with predictions generated for the 2040s. Files are archived in a model instance folder in CUAHSI's HydroShare site. See link for more details.
    1
    4 days ago
  • Contains raw data and four calculated indexes (Index of Watershed Integrity, Index of Catchment Integrity, Environmental Water Quality Index, and Hydrogeomorphological Index) for the six subunits of the La Laborcilla Microwatershed in the Central Mexican Plateau. This dataset is not publicly accessible because: PI doesn't have access to the most up-to-date data; the Universidad Autonoma de Queretaro is the data steward. Interested parties should contact the author. It can be accessed through the following means: PI doesn't have access to the most up-to-date data, so interested parties should contact the author. Format: Data are stored in Excel spreadsheets. PI doesn't have access to the most up-to-date data, so interested parties should contact the author. This dataset is associated with the following publication: Sarmiento-Martinez, M., S. Leibowitz, M.L. Otte, R. Pineda-Lopez, D.P. Garcia-Tello, H. Luna-Soria, L.I. Medina Pacheco, E. Hernandez Perez, and V.H. Cambron-Sandoval. Index of Watershed Integrity (IWI) of a Central Mexican Plateau Microwatershed: An Instrument of Environmental Governance. JOURNAL OF THE AMERICAN WATER RESOURCES ASSOCIATION. American Water Resources Association, Middleburg, VA, USA, 61(3): e70028, (2025).
    0
    4 days ago
  • 2023 CMAQ Simulation output for select sites in Louisiana - Description: CMAQv5.5+ public version downloaded 2/13/2025. (SHA: 783dc11668a83b9ec243c2cf7d20471ecd34dfae). Last Merge on 5.5 plus: Jan 31. Chemical mechanism: CRACMM2. Dry deposition: STAGE with Emerson et al. 2020 aerosol parameters. Vertical diffusion: acm. Windblown dust emissions: on. Sea spray emissions: on. Lightning NOx: on. Land surface model: PX. Bidirectional ammonia exchange: on. Fertilizer NH3 emissions: computed in-line. HONO production on ground surfaces: on. Gravitational settling of aerosols: on. Scale free trop O3 to potential vorticity: off. Biogenic emissions: BEIS in-line. Aerosol optics: approx of Mie Theory for internally homogeneous particle. WRF v4.6.0. BCON: GEOSCF mapped to cracmm2. Solver: EBI. Compiler: Intel 23.2. OMI file set to use 2019 data. Entire month of December 2022 (using representative days) discarded as spinup. HAP emissions are from explicit emission factors rather than VOC speciation. Species definitions file for post processing concentrations updated 2/27/2025. Simulations and post-processing performed by Havala Pye. - Original file locations: /work/MOD3DEV/has/2023cracmm_ages/runs/ Species output in ppb included SPECIES_1 'ACETALDEHYDE' SPECIES_2 'ACROLEIN' SPECIES_3 'BUTADIENE13' # 1,3-butadiene SPECIES_4 'BENZENE' SPECIES_5 'FORMALDEHYDE' SPECIES_6 'TOLUENE' SPECIES_7 'ETHB' # Ethylbenzene SPECIES_8 'STYRENE' SPECIES_9 'CO' # carbon monoxide SPECIES_10 'MOH' # methanol SPECIES_11 'MVK' # methyl vinyl ketone SPECIES_12 'MACR' # methacrolein SPECIES_13 'ISOP' # isoprene Files were created by the write site program distributed with CMAQ (https://github.com/USEPA/CMAQ/blob/main/POST/writesite/README.md). Species included are defined above. Log files for the write site program are included as writesite*.txt. A jupyter notebook in ipynb and html format shows some of the data. Please cite the following for CMAQ with CRACMM2: Skipper, T. N., D'Ambro, E. L., Wiser, F. C., McNeill, V. F., Schwantes, R. H., Henderson, B. H., Piletic, I. R., Baublitz, C. B., Bash, J. O., Whitehill, A. R., Valin, L. C., Mouat, A. P., Kaiser, J., Wolfe, G. M., St. Clair, J. M., Hanisco, T. F., Fried, A., Place, B. K., and Pye, H. O. T.: Role of chemical production and depositional losses on formaldehyde in the Community Regional Atmospheric Chemistry Multiphase Mechanism (CRACMM), Atmos. Chem. Phys., 24, 12903–12924, https://doi.org/10.5194/acp-24-12903-2024, 2024. DISCLAIMER: This data product has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for public release. At the time of release, the data had not yet been published in peer-reviewed literature. The data is provided for research and the user should verify the data is suitable for their intended use.
    4
    4 days ago
  • 2023 CMAQ Simulation output for South DeKalb - CMAQ simulations performed by Havala Pye ORD/CEMM/AESMD - simulation labels: cmaq55plus (base) and cmaq55plus_nofire (wildfire, agricultural fire, and prescribed fire emissions in US and outside US set to zero) - Description: CMAQv5.5+ public version downloaded 2/13/2025. (SHA: 783dc11668a83b9ec243c2cf7d20471ecd34dfae). Last Merge on 5.5 plus: Jan 31. Chemical mechanism: CRACMM2. Dry deposition: STAGE with Emerson et al. 2020 aerosol parameters. Vertical diffusion: acm. Windblown dust emissions: on. Sea spray emissions: on. Lightning NOx: on. Land surface model: PX. Bidirectional ammonia exchange: on. Fertilizer NH3 emissions: computed in-line. HONO production on ground surfaces: on. Gravitational settling of aerosols: on. Scale free trop O3 to potential vorticity: off. Biogenic emissions: BEIS in-line. Aerosol optics: approx of Mie Theory for internally homogeneous particle. WRF v4.6.0. BCON: GEOSCF mapped to cracmm2. Solver: EBI. Compiler: Intel 23.2. OMI file set to use 2019 data. Entire month of December 2022 (using representative days) discarded as spinup. HAP emissions are from explicit emission factors rather than VOC speciation. Species definitions file for post processing concentrations updated 2/27/2025. Simulations and post-processing performed by Havala Pye. - Original file locations: /work/MOD3DEV/has/2023cracmm_ages/runs/ Files were created by the write site program distributed with CMAQ (https://github.com/USEPA/CMAQ/blob/main/POST/writesite/README.md). Species included are defined in terms of raw models species in SpecDef_Conc_cracmm2_v2.txt. The description of raw model species is at https://github.com/USEPA/CRACMM/blob/main/metadata/cracmm2/cracmm2_metadata.csv. Log files for the write site program are included as writesite*.txt. A jupyter notebook in ipynb and html format shows some of the data. Please cite the following for CMAQ with CRACMM2: Skipper, T. N., D'Ambro, E. L., Wiser, F. C., McNeill, V. F., Schwantes, R. H., Henderson, B. H., Piletic, I. R., Baublitz, C. B., Bash, J. O., Whitehill, A. R., Valin, L. C., Mouat, A. P., Kaiser, J., Wolfe, G. M., St. Clair, J. M., Hanisco, T. F., Fried, A., Place, B. K., and Pye, H. O. T.: Role of chemical production and depositional losses on formaldehyde in the Community Regional Atmospheric Chemistry Multiphase Mechanism (CRACMM), Atmos. Chem. Phys., 24, 12903–12924, https://doi.org/10.5194/acp-24-12903-2024, 2024. DISCLAIMER: This data product has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for public release. At the time of release, the data had not yet been published in peer-reviewed literature. The data is provided for research and the user should verify the data is suitable for their intended use.
    4
    4 days ago
  • AQS data is a publicly available dataset, which is part of this study. This data can be found on EPA website https://aqs.epa.gov/aqsweb/airdata/download_files.html (accessed on 1 April 2023). PA data is a 3rd party data and restrictions apply to the availability of these data. Data was obtained from Purple Air and are available from PurpleAir API https://community.purpleair.com/t/making-api-calls-with-the-purpleair-api/180 (accessed on 1 April 2023) with the permission of Purple Air. HMS smoke plume data is publicly available and can be downloaded at Office of Satellite and Product Operations website https://www.ospo.noaa.gov (accessed on 1 April 2023). The codes to download and analyze data in this paper is available at this GitHub repo https://github.com/hyang199723/PAFusion (uploaded on 30 June 2023). This dataset is associated with the following publication: Yang, H., S. Ruiz-Suarez, B. Reich, Y. Guan, and A. Rappold. A data fusion approach to assessing the contribution of wildland fire smoke to fine particulate matter in California. Remote Sensing. MDPI, Basel, SWITZERLAND, 15(17): 1, (2023).
    3
    4 days ago
  • Journal article published in PLOS One, Vol 20, Issue 5, e0320862, 2025; DOI: https://doi.org/10.1371/journal.pone.0320862; PMC12064016. The datasets generated and analyzed during the current study are provided in Supplemental S1 File. The RNA-seq data is Protein Atlas Version 23 from the Human Protein Atlas website (https://www.proteinatlas.org/about/download, “RNA HPA cell line gene data” released 2023.06.19). All FASTQ files and aligned counts for the U.S. EPA TempO-seq data have been deposited into NCBI Gene Expression Omnibus under the accession number GSE288929 and are publicly available at: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE288929. The R code is available through FigShare at: https://doi.org/10.23645/epacomptox.27341970.v1. This dataset is associated with the following publication: Word, L., C. Willis, R. Judson, L. Everett, S. Davidson-Fritz, D. Haggard, B. Chambers, J. Rogers, J. Bundy, I. Shah, N. Sipes, and J. Harrill. TempO-seq and RNA-seq Gene Expression Levels are Highly Correlated for Most Genes: A Comparison Using 39 Human Cell Lines. PLOS ONE. Public Library of Science, San Francisco, CA, USA, 20(5): e0320862, (2025).
    1
    4 days ago
  • Supplementary and data for: Light modulates morphology more than trophic and physiological dynamics of six Caribbean corals
    1
    4 days ago
  • Microsoft Excel-based, user-friendly dataset that allows researchers to quickly identify surrogate microorganisms to use in place of pathogenic microorganisms, in just-in-time research.
    1
    4 days ago
  • The dataset Salmon Utilization of Estuarine Habitat contains tables holding information on a telemetry study of salmonid smolt migration done in Oregon’s Yaquina and Alsea estuaries from 2004 to 2007. A portion of this research has been published as Johnson et al. (2010). The data are contained in an Access relational database, and it is recommended that the user view the relationships in the database to understand its structure.
    2
    4 days ago
  • Input and output data files are included for a SWAT model developed for the Upper Rogue River, OR, USA. The model was first developed using EPA HAWQSv1, then routing corrected for incorrect reservoirs, water inputs and withdrawals and reservoir outflows added, and finally calibrated for flow using SWAT-CUP. The model files are archived in CUAHSI's HydroShare site which will (in the future) allow model instances to be run online if desired. See link for more details.
    1
    4 days ago
  • To assess the variability of low-abundance oligonucleotide detection across sample matrices, we spiked DNA reference standards (meta sequins) into replicate wastewater DNA extracts at logarithmically decreasing mass-to-mass percentages (m/m%) and deeply sequenced them on the Illumina platform. This dataset summarizes the experimental conditions and results of the detection frequencies of those oligonucleotides as well as detailed descriptions of the DNA reference standards used. This dataset is associated with the following publication: Davis, B., P. Vikesland, and A. Pruden. Evaluating Quantitative Metagenomics for Environmental Monitoring of Antibiotic Resistance and Establishing Detection Limits. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(12): 6192-6202, (2025).
    2
    4 days ago
  • 2023 CMAQ Simulation output for select sites in the Northeast US - CMAQ simulations performed by Havala Pye ORD/CEMM/AESMD - simulation labels: cmaq55plus (base) and cmaq55plus_nofire (wildfire, agricultural fire, and prescribed fire emissions in US and outside US set to zero) - Description: CMAQv5.5+ public version downloaded 2/13/2025. (SHA: 783dc11668a83b9ec243c2cf7d20471ecd34dfae). Last Merge on 5.5 plus: Jan 31. Chemical mechanism: CRACMM2. Dry deposition: STAGE with Emerson et al. 2020 aerosol parameters. Vertical diffusion: acm. Windblown dust emissions: on. Sea spray emissions: on. Lightning NOx: on. Land surface model: PX. Bidirectional ammonia exchange: on. Fertilizer NH3 emissions: computed in-line. HONO production on ground surfaces: on. Gravitational settling of aerosols: on. Scale free trop O3 to potential vorticity: off. Biogenic emissions: BEIS in-line. Aerosol optics: approx of Mie Theory for internally homogeneous particle. WRF v4.6.0. BCON: GEOSCF mapped to cracmm2. Solver: EBI. Compiler: Intel 23.2. OMI file set to use 2019 data. Entire month of December 2022 (using representative days) discarded as spinup. HAP emissions are from explicit emission factors rather than VOC speciation. Species definitions file for post processing concentrations updated 2/27/2025. Simulations and post-processing performed by Havala Pye. - Original file locations: /work/MOD3DEV/has/2023cracmm_ages/runs/ Files were created by the write site program distributed with CMAQ (https://github.com/USEPA/CMAQ/blob/main/POST/writesite/README.md). Species included are defined in terms of raw models species in SpecDef_Conc_cracmm2_v2.txt. The description of raw model species is at https://github.com/USEPA/CRACMM/blob/main/metadata/cracmm2/cracmm2_metadata.csv. Log files for the write site program are included as writesite*.txt. A jupyter notebook in ipynb and html format shows some of the data. Please cite the following for CMAQ with CRACMM2: Skipper, T. N., D'Ambro, E. L., Wiser, F. C., McNeill, V. F., Schwantes, R. H., Henderson, B. H., Piletic, I. R., Baublitz, C. B., Bash, J. O., Whitehill, A. R., Valin, L. C., Mouat, A. P., Kaiser, J., Wolfe, G. M., St. Clair, J. M., Hanisco, T. F., Fried, A., Place, B. K., and Pye, H. O. T.: Role of chemical production and depositional losses on formaldehyde in the Community Regional Atmospheric Chemistry Multiphase Mechanism (CRACMM), Atmos. Chem. Phys., 24, 12903–12924, https://doi.org/10.5194/acp-24-12903-2024, 2024. DISCLAIMER: This data product has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for public release. At the time of release, the data had not yet been published in peer-reviewed literature. The data is provided for research and the user should verify the data is suitable for their intended use.
    4
    4 days ago
  • Development of band ratio from Sentinel-2 and SCHISM model input and output files. Portions of this dataset are inaccessible because: The file is 42GB and too large to be uploaded to ScienceHub or hosted in EDG. They can be accessed through the following means: Contact the Principal Investigator, Blake Schaeffer at schaeffer.blake@epa.gov. Format: Development of band ratio from Sentinel-2 and SCHISM model input and output files. This dataset is associated with the following publication: Lebrasse, M., B. Schaeffer, D.R. Bohnenstiehl, C.L. Osburn, M. Coffer, R. He, P. Whitman, W. Salls, and D. Graybill. Winter-Spring dynamics of dissolved organic carbon fluxes driven by precipitation in a North Carolina tidal marsh. ESTUARINE, COASTAL AND SHELF SCIENCE. Elsevier Science Ltd, New York, NY, USA, 322: 109361, (2025).
    1
    4 days ago
  • This dataset contains spatial and tabular data documenting land cover and surface exposure ages along the Colorado and San Juan Rivers within the backwaters of Lake Powell Reservoir. Data were derived from aerial imagery collected as part of the USDA NAIP Program between 2009-2021, along with topobathymetric elevation data collected from Lake Powell Reservoir. For more information on the data contained here, please see "0-README.txt" within the attached .zip folder.
    1
    4 days ago
  • This dataset is non-EPA-owned. Some of the analyses are based on previous use of CMAQ emissions and meteorological files for the ALPACA period. The links to those ScienceHub entries are attached. Portions of this dataset are inaccessible because: Non-EPA-owned data by the first author. They can be accessed through the following means: Contact Natalie Brett (natalie.brett@latmos.ipsl.fr) or Steve Arnold (S.Arnold@leeds.ac.uk). Format: Analyses in this paper are based on model simulations (described in a previous paper) that used EPA data (netCDF files containing CMAQ emissions and meteorological inputs). See the associated links above which will be published upon publication of the associated manuscripts. This dataset is associated with the following publication: Brett, N., S. Arnold, K. Law, J. Raut, T. Onishi, B. Barret, E. Dieudonné, M. Cesler-Maloney, W. Simpson, S. Bekki, J. Savarino, S. Albertin, R. Gilliam, K. Fahey, G. Pouliot, D. Huff, and B. D'Anna. Estimating Power Plant Contributions to Surface Pollution in a Wintertime Arctic Environment. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 2(5): 943-956, (2025).
    4
    4 days ago
  • The project entailed deployment of an on-site on-demand peracetic acid (PAA) disinfectant pilot system at a combined sewer storage facility in Akron, OH (Akron Rack 40). The pilot system was constructed and wet tested in Cincinnati, OH at EPA facilities and transported via trailer to the Akron site. The system produced a dilute peracetic acid disinfection solution via reaction of two industrial detergent powders (TAED - Tetraacetylethylenediamine and SPC - Sodium percarbonate) in a water matrix. The disinfectant was injected into a simulated combined sewer overflow (CSO) stream via mixing Little Cuyahoga River water with raw sewage drawn from the Akron sewer system. Samples were drawn after 5-minute, 10-minute and 15-minute contact time to determine efficacy of the system at reducing pathogens as primarily determined through E. coli inactivation. Sample sets from two trials were also analyzed for inactivation of Heterotrophic bacteria and Bacteriophage MS2 as surrogate for viral inactivation.
    1
    4 days ago
  • This dataset includes the USEEIO model "USEEIO v2.5.1-waxwing-22" in Excel format. This model replaces USEEIOv2.5-waxwing-22 from the USEEIO v2.5 models dataset, in which a bug was discovered rendering the greenhouse gas data incorrect. Therefore USEEIOv2.5-waxwing-22 is deprecated. The bug does not apply to any other USEEIO v2.5 models and therefore this release only includes a replacement for the one faulty model. This model was generated with useeior v1.7.1, using the model specification file "USEEIOv2.5.1-waxwing-22.yml" that is linked below. For more information on this model see the associated USEEIO v2.5 models dataset page and the associated EPA report. Links to these resources are provided below. Please cite this dataset as "Young, Ben, and Wesley Ingwersen. 2025. USEEIO v2.5.1 waxwing model. Data.gov. https://doi.org/10.23719/1532304.". This dataset is associated with the following publication: Ingwersen, W.W., J. Namovich, B. Young, and J. Vendries. Estimating embodied environmental flows in international imports for the USEEIO Model. U.S. Environmental Protection Agency, Washington, DC, USA, 2024.
    1
    4 days ago
  • Data for "Mapping the value of commercial fishing and potential costs of offshore wind energy on the U.S. West Coast: Towards an assessment of resource use tradeoffs". This dataset is associated with the following publication: Feist, B.E., R. Griffin, J.F. Samhouri, L. Riekkola, A.O. Shelton, Y.A. Chen, K. Somers, K. Andrews, O.R. Liu, and J. Ise. Mapping the value of commercial fishing and potential costs of offshore wind energy on the U.S. West Coast: Towards an assessment of resource use tradeoffs. PLOS ONE. Public Library of Science, San Francisco, CA, USA, 20(3): e0315319, (2025).
    1
    4 days ago
  • Table 2. SWAT Model Calibration for Soldier Creek, KS. Subbasins 1-7. Variable_n refers to calibration results for subbasin n, from 1 (headwaters of Upper Soldier Creek) to 3 (mouth of Upper Soldier Creek) to 7 (Soldier Creek outlet). NS = Nash-Sutcliffe coefficient, MSE = mean squared error, PBIAS = % bias, KGE = Kling-Gupta Efficiency.
    1
    4 days ago
  • Figure 4 data set. Upper Soldier Creek Climate Scenario Summary. RCP4.5 scenarios for 2021-2050 time frame as compared to 2014 baseline. Simulations were run with an initial groundwater concentration of zero ppm TP except as indicated by * (0.04 ppm TP). Annual total TP loads (lbs TP/year) and number of exceedances of annual daily load target (> 1039.6 lb TP/day) at mouth of Upper Soldier Creek are shown for each climate simulation.
    1
    4 days ago
  • Data underlying Figure 5. Upper Soldier Creek, KS predicted daily total phosphorus loads normalized for year of average precipitation adjusted for climate change (2021 – 2050) based on GISS-E2-H change scenario for RCP4.5 and implementation of least-cost optimized management solutions for 2014. Target load of 1039.6 lb P/day is shown with dashed line to highlight projected exceedances.
    1
    4 days ago
  • This repository contains data for the manuscript “Three centuries of biogeochemical change in a temperate embayment as revealed by sediment core stable isotopes, radiometric dating, and historical ecology”, by Sawyer J. Balint, Morgan Schwartz, Andrew Gray, Tim Cranston, Robinson W. Fulweiler, Melissa Hagy, Rick McKinney, and Autumn Oczkowski. This dataset is associated with the following publication: Balint, S.J., M. Schwartz, A. Gray, T. Cranston, R.W. Fulweiler, M. Ederington-Hagy, R. McKinney, and A. Oczkowski. Three centuries of biogeochemical change in a temperate embayment as revealed by sediment core stable isotopes, radiometric dating, and historical ecology. MARINE ECOLOGY PROGRESS SERIES. Inter-Research, Luhe, GERMANY, 757: 37-52, (2025).
    1
    4 days ago
  • Here we provide data from water samples that were collected twice monthly, from April 26, 2021 and April 25, 2024, from sixteen stations throughout the San Juan Bay Estuary, Puerto Rico.
    1
    4 days ago
  • These are the data hosted by Rhode Island Department of Environmental Management and are from a network of monitoring buoys in Narragansett Bay. The dataset inlcudes high frequency measurements of pH, dissolved oxygen, temperature, salinity, and chlorophyll a. This dataset is associated with the following publication: Wang, H., D.L. Codiga, H. Stoffel, C. Oviatt, K. Huizenga, and J. Grear. Effect of nutrient reductions on dissolved oxygen and pH: a case study of Narragansett Bay. Frontiers in Marine Science. Frontiers, Lausanne, SWITZERLAND, 11: 1374873, (2024).
    1
    4 days ago
  • Since the national validation of the sponge-stick based method for detection of Bacillus anthracis spores in environmental samples, there have not been focused efforts to address the low throughput nature of the method, which processes only one sample at one time. Sample processing remains a serious bottleneck for rapidly analyzing large numbers of samples expected from a biological warfare attack. Therefore, we developed a high-throughput method to simultaneously process multiple sponge-stick samples to be better prepared for rapid response and recovery after wide area anthrax incidents. In this method, sponges are placed in 50 mL tubes containing 25 mL buffer and shaken to release spores, after which the buffer is recovered for analysis. We determined that an additional rinse step, conducted in the same tubes with 10 mL buffer, further increased spore recovery from sponge-stick by approximately 10%. We determined that orbital shaking and multi-tube vortexing were both more effective than reciprocating shaking for recovering spores. We conducted simultaneous processing of up to 12 sponge-stick samples and demonstrated comparable spore recovery efficiencies to the traditional low-throughput stomacher-based method (approximately 60% recovery at 102-spore level and 75% recovery at 104-spore level for both methods in three replicate experiments, P > 0.05 for two-tailed T-tests for each experiment and spore level). We also demonstrated that our high-throughput method could be integrated with Rapid Viability-Polymerase Chain Reaction (RV-PCR) analysis and could detect levels as low as 40 spores per sponge even when challenged by a PCR particulate contaminant. This dataset is associated with the following publication: Brisson, V., S. Kane, and S. Shah. Development of a high-throughput method for processing sponge-stick samples to detect viable Bacillus anthracis spores. JOURNAL OF MICROBIOLOGICAL METHODS. Elsevier Science Ltd, New York, NY, USA, 235: 107149, (2025).
    2
    4 days ago
  • Selected bacterial, and antibiotic resistance genes sul and INTI1 concentrations by qPCR assays, and ASV tables of bacterial communities growing in biofilms incubated in river -and wastewater treatment plant effluent amended -river water. This dataset is associated with the following publication: Eytcheson, S., S. Brown, H. Wu, C. Nietch, P. Weaver, J. Darling, E. Pilgrim, T. Purucker, and M. Molina. Assessment of Emerging Pathogens and Antibiotic Resistance Genes in the Biofilm of Microplastics Incubated Under a Wastewater Discharge Simulation. Environmental Microbiology. Wiley-Blackwell Publishing, Hoboken, NJ, USA, 27(5): e70103, (2025).
    3
    4 days ago
  • Zip file contents: PDF file includes 1. Supplement 1: Selected Baseline Results (PDF) 2. Supplement 2: Selected Mitigation Scenario Results 3. Supplement 3: FASOMGHG Algebraic Structure Excel of Supplement 2 outputs. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • ArcGIS raster maps for the wildfire risk and tree loss probability in the United Stated for the paper "Estimating climate-sensitive wildfire risk and tree mortality models for use in broad-scale U.S. forest carbon projections" as published in Forests. Citation information for this dataset can be found in Data.gov's References section.
    1
    4 days ago
  • Twenty four months of daily water quality results (Daily sediment loads, concentrations of Fecal Indicator Bacteria) will be made available electronically and shared with public via the IBWC GIS-based website (https://usibwc.maps.arcgis.com/apps/webappviewer/index.html?id=7be2cf73494c4847ab44718492c48315). This dataset is associated with the following publication: Biggs, T., N. Mladenov, S. Garcia, Y. Yuan, D. Sousa, A. Grant, E. Piazza, T. Magdalena-Weary, C. Summerlin, and D. Liden. Fluorescence-Based Indicators of Escherichia coli and Untreated Wastewater: Turbidity Correction and Comparison of In Situ and Benchtop Fluorometers in a Sewage-Polluted Urban River. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 5(5): 2212-2222, (2025).
    2
    4 days ago
  • OSU data for lamprey in the Goose Lake Basin. This dataset is associated with the following publication: Dickey, J., B. Clemens, M. Dumelle, and M. Davis. Modeling lamprey distribution using flow, geomorphology, and elevation in a terminal lake system. TRANSACTIONS OF THE AMERICAN FISHERIES SOCIETY. American Fisheries Society, Bethesda, MD, USA, vnaf017, (2025).
    1
    4 days ago
  • Raw data for experiment using two species of Atlantic/Caribbean corals, Acropora cervicornis and Pseudodiploria clivosa. Data include water quality parameters, calcification, and tissue surface area. A ReadMe spreadsheet is included.
    1
    4 days ago
  • Batch collection of environmental data modeling workflow for gridded land surface models (LSMs) through DEM acquisition and HMS Restful API tailored for VELMA initialization. This dataset is associated with the following publication: Venable, K., J. Johnston, and S. Leduc. Streamlining land surface model Initialization: Automated data retrieval for VELMA using HMS REST API and GDAL. ENVIRONMENTAL MODELLING & SOFTWARE. Elsevier Science, New York, NY, 191: 106492, (2025).
    1
    4 days ago
  • A laboratory-based microcosm study was conducted from September 2023 to July 2024 by the Office of Research (ORD) Cincinnati Lab (ORD-CESER-LRTD-CAISB). QA Category B data was generated following established methodologies and quality-assurance procedures. ORD clearance policy requirements for internal technical review, quality assurance review and supervisor reviewer/approval were met. This data is to be published on ScienceHub following satisfaction of EPA ORD policies. No interpretation of the data is provided. The results of this study will be described in detail in a publication subjected to external, expert peer review. Sediments, collected from the Lower Coeur d’Alene Basin (CDA) in the Bunker Hill Mining and Metallurgical Complex Superfund Site (Bunker Hill), were used in microcosms set up and monitored by ORD Cincinnati staff. The study was designed to evaluate the impact of repeated wetting and drying cycles on sediment porewater metal concentrations in the Lower CDA. Sediments were subjected to three wetting-drying cycles, and porewater was sampled throughout the duration of the experiment. Two sediment types were subjected to two different treatments (Permanently wet vs wet/dry) with 3 replicates of each, yielding 12 total microcosms. Each wetting-drying cycle lasted 30 days and was followed by 30 days of drying (Figure 1). This data package summarizes sediment, sediment porewater and surface water results including total metal concentrations in sediment and sediment porewater, dissolved organic carbon (DOC) concentrations, dissolved iron and sulfide, UV absorbance at 254 nm, YSI measurements of porewater, sulfate concentrations, times series data of redox potential (Eh), and lead (Pb) speciation analysis of select samples. See attached QA Memo detailing QA/QC procedures used for each parameter and a schematic of the microcosms.
    1
    4 days ago
  • The datasets include: 1. the measurements of glucose concentrations in each mesocosm, 2. the sonde measurements in each of the mesocosms at the beginning and end of the experiment, 3.the quantities of the cyanobacteria measured by FlowCam at each week of the experiment, 4. the microcystin concentrations in each mesocosm for the first 4 weeks of the experiment, 5. the concentration of total nitrogen and phosphorous in the mesocosms at the beginning and end of the experiment. This dataset is associated with the following publication: Gastaldo, C., and S. Vesper. HABS-BLOCKS© Inhibited Microcystis and Planktothrix and Reduced Microcystin Concentrations in a Lake Water Mesocosm Study. Microorganisms. MDPI, Basel, SWITZERLAND, 13(5): 1074, (2025).
    1
    4 days ago
  • Publication of EPA’s Nutrient Inventory is a critical step towards thorough mapping and accounting of sources of N and P to US landscapes. However, summaries of nutrients within accumulative watersheds are needed to develop accurate watershed-level nutrient budgets and relate landscape inputs to instream nutrient concentrations. This subproduct will accumulate the Nutrient Inventory across available years for all streams and lakes within the medium resolution National Hydrography Dataset Plus version 2 (NHDPlus), i.e., 2.6 million stream segments and nearly 400,000 lakes across the conterminous US. These data will allow OW to easily and rapidly identify the dominant sources of N or P for any stream segment or lake in the US. Further, these data will be made accessible through the EPA’s StreamCat and LakeCat datasets and a soon-to-be released online database and an application programming interface (API). This database and API will make nutrient watershed accumulations readily accessible and easily integrated by a variety of OW programs and tools. Finally, the accumulated nutrient data will serve as the basis for a multiple proposed StRAP subproducts and models in SSWR.401, SSWR.404, and SSWR.405. These data will contribute directly to OW, region, and state efforts to identify and reduce non-point nutrient sources. Having spatially explicit data about nutrient sources and loads can help target and inform restoration and conservation efforts, as well as more formal TMDLs, nutrient reduction plans, and groundwater management approaches. This subproduct will produce a database of accumulated nutrient values for at least 2.6 million stream segments and 400,000 lakes of the medium resolution National Hydrography Dataset Plus version 2 (NHDPlus). These data will be made accessible through the StreamCat and LakeCat datasets. They will also be made available as an online database with application programming interface (API) that will facilitate data acquisition and use by OW and state partners. This database will provide a state-of-the science accounting of nutrient sources that drain to all streams and lakes in the conterminous US. It will allow EPA and state partners to identify dominant sources of N and P to individual waterbodies and will greatly facilitate nutrient reduction strategies and planning.
    1
    4 days ago
  • This dataset contains links to data supporting the journal article, "High radiative forcing climate scenario relevance analyzed with a ten-million-member ensemble". Note that all the data and code is also linked to from the journal article itself. Citation information for this dataset can be found in Data.gov's References section.
    3
    4 days ago
  • This is a dataset of malathion washoff data from experiments performed using a rainfall simulator. Two types of malathion - a technical (off-the shelf insecticide) and an analytical grade - were used in this study. They were applied to either concrete or asphalt coupons and allowed to dwell on the surface for 1, 6, or 24 hours. Artificial rainfall was then applied at an intensity of 1 or 2.5 in/hour and rainfall runoff samples collected an analyzed for malathion over the course of an hour.
    1
    4 days ago
  • Motivated by the COVID-19 pandemic, research was conducted to evaluate UVC radiation emitting devices that are potentially capable of inactivating SARS-CoV-2 on surfaces found in the built environment to augment chemical-based surface disinfection approaches. In this study, we evaluated the efficacy of a board-spectrum pulsed xenon light, a continuous UVC light-emitting diode (LED), and a Far UV light source against SARS-CoV-2. Experiments were conducted with the SARS-CoV-2 virus inoculated in either tissue culture media or simulated saliva onto porous and nonporous surfaces (three materials total). The dataset contains the log10 recoveries of SARS-CoV-2 (TCID50/sample) and calculated Log10 reductions for all tests.
    1
    4 days ago
  • Other Test Method (OTM)-50 data for fluorinated volatile compounds in the emissions from air pollution controls at a fluoropolymer manufacturer. This dataset is associated with the following publication: Shields, E., W. Roberson, J. Ryan, and S. Jackson. The Use of Air Pollution Controls to Reduce the Gas-phase Emissions of Per- and Polyfluoroalkyl Substances from a Fluoropolymer Manufacturing Facility. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 0, (2025).
    4
    4 days ago
  • Emissions to air of select volatile organic compounds (VOCs) for the U.S. in 2017 by major source groups. Methods follow those from Pye et al. 2023 (https://doi.org/10.5194/acp-23-5043-2023). Species include: 1,3-butadiene, Acrolein (or 2-propenal), Acrylamide, Acrylonitrile, Ethylene oxide, Perchloroethylene (or Tetrachloroethylene), Propylene oxide, Styrene, Toluene, Vinyl chloride, and Xylenes (multiple isomers). Sources include: gasoline vehicles (on-road and non-road), chemical products, other area sources, fires (wildland, prescribed, agricultural, and others), other point sources, EGUs (Electric Generating Units), oil and gas, diesel vehicles (on-road and non-road), and residential wood combustion.
    1
    4 days ago
  • Dataset contains data for creating figures in the article. This dataset is associated with the following publication: Sarwar, G., F. Sidi, H. Simon, B. Henderson, J. Willison, R. Gilliam, C. Hogrefe, K. Foley, R. Mathur, and W. Appel. Representing particulate nitrate photolysis over seawater improves CMAQ ozone predictions over the contiguous United States. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 970: 178968, (2025).
    7
    4 days ago
  • This series of documents describes the characterization of filtered wood smoke for volatile and semi-volatile organic compounds after passing through the MASKON CAPR filtration system.
    2
    4 days ago
  • This report details the acceptance test performed on the exposure system created for the MASKON project. This system allows for air to be filtered by any sorbent material and then directly delivered to participants respiratory zone with little loss of volatile compounds and particulate matter. In addition, this novel system permits moderate to high levels of exercise to be performed during exposure.
    1
    4 days ago
  • These documents highlight the efficiency of the controlled exposure system developed for the MASKON study. These tests show the systems incredibly high capabilities for filtering particulate matter.
    2
    4 days ago
  • Data for the published results in Chemosphere Journal. This includes regeneration efficiency data and GAC characterization data. This dataset is associated with the following publication: Didenko, T., A. Lau, A.L. Purohit, J. Feng, B. Pinkard, M. Ateia, and I.V. Novosselov. Regeneration of PFAS-laden granular activated carbon by modified supercritical CO2 extraction. CHEMOSPHERE. Elsevier Science Ltd, New York, NY, USA, 370: 143986, (2025).
    1
    4 days ago
  • This is the data used in the publication "Amendment effectiveness and seasonal variations in a lead contaminated acidic wetland" in Applied Geochemistry (https://doi.org/10.1016/j.apgeochem.2025.106396). This dataset is associated with the following publication: Noerpel, M.R., A.M. Wade, A.R. Betts, J. Goetz, R. Ford, A. Krause, M. Zeolla, D. Cutt, S.M. Wilson, and T.P. Luxton. Amendment effectiveness and seasonal variations in a lead contaminated acidic wetland. APPLIED GEOCHEMISTRY. Elsevier Science Ltd, New York, NY, USA, 185: 106396, (2025).
    2
    4 days ago
  • This dataset includes data for tissue surface area, calcification, and water quality (turbidity and PAR) for an experiment that exposed the stony coral, Porites lobata, to the flocculant, chitosan. This dataset is associated with the following publications: Hankins, C., K. McDaniel, A. Glahn, D. Lasseigne, and J. Slay. Chitosan has the potential to improve water quality without negative effects on the stony coral, Porites lobata. Presented at SETAC North America 45th Annual Meeting, Fort Worth, TX, USA, 10/20/2024 - 10/24/2024. Hankins, C., K. McDaniel, A. Glahn, D. Lasseigne, and J. Slay. Chitosan has the potential to improve water quality without negative effects on the coral, Porites lobata. JOURNAL OF ENVIRONMENTAL MANAGEMENT. Elsevier Science Ltd, New York, NY, USA, 380: 124964, (2025). Hankins, C. Chitosan Has Potential to Improve Water Quality in West Maui without Negative Effects on the Coral, Porites lobata. Presented at Presentation to Maui Community, Maalaea, HI, USA, 03/18/2024 - 03/22/2024.
    3
    4 days ago
  • This dataset combines fish assemblage data from the EPA National Rivers and Streams Assessment, elevation data from an EPA R package called elevatr, fish species native/non-native designations from the USGS Nonindigenous Aquatic Species (NAS) database, glaciation shapefiles from a public online textbook, and phylogenetic and fish trait data from two previously published studies. This dataset is associated with the following publication: Gallagher, B., E. Santos, M. Dumelle, P. Kaufmann, and J. Ebersole. Geologic History Explains Freshwater Fish Species Richness Across the Conterminous USA. Global Ecology and Biogeography. Wiley InterScience, Silver Spring, MD, USA, 34(10): e70139, (2025).
    7
    4 days ago
  • Data and code availability •The full proteomics mass spectrometry data were uploaded into the PRoteomics IDEntifications Database (PRIDE) and are publicly available as of the date of publication. (65) EV isolation methods and study logistics have been uploaded to the EV-Track knowledgebase (EV-TRACK ID: EV230971). (66) Cell viability, cell permeability, NTA, and proteomics data were also uploaded to the UNC Center for Environmental Medicine, Asthma and Lung Biology (UNC-CEMALB)-Dataverse. (67) The PRIDE project accession number, EV-TRACK ID, and accession link to UNC-CEMALB-Dataverse are listed in the key resources table. •Script used to analyze NTA and proteomics data were organized via the UNC-CEMALB Github website and is publicly available as of the date of publication. (68) •Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request. This dataset is associated with the following publication: Vitucci, E., C. Carberry, A. Payton, L. Herring, A. Mordant, S. McCullough, and J. Rager. Characterizing the Extracellular Vesicle Proteomic Landscape of the Human Airway using In vitro Organotypic Multi-Cellular Models. iScience. Elsevier B.V., Amsterdam, NETHERLANDS, 26(11): 108162, (2023).
    1
    4 days ago
  • This data contains daily, ZCTA-level records of five meteorological variables: mean temperature, maximum temperature, minimum temperature, relative humidity, and dewpoint. The geographic extent of the data is the state of North Carolina, and the data can be used in spatial analyses if it is joined with 2010-2019 ZCTA boundaries from the U.S. Census. The associated codebook describes each variable including its format, units, and range of values. This dataset is associated with manuscript: "Effects of Extreme Humidity and Heat on Ventricular Arrhythmia Risk in Patients With Cardiac Devices" (DOI: 10.1016/j.jacadv.2024.101463). This dataset is associated with the following publication: Keeler, C., S. Cleland, K. Hill, A. Mazzella, W. Cascio, A. Rappold, and L. Rosman. Effects of Extreme Humidity and Heat on Ventricular Arrhythmia Risk in Patients With Cardiac Devices. JACC: Advances. Elsevier B.V., Amsterdam, NETHERLANDS, 4(1): 101463, (2025).
    2
    4 days ago
  • Data associated with this publication includes stormwater model .inp and report files as well as GIS files for visualizing the results. The files are not allowed to be released due to a non-disclosure agreement with the stormwater utility. This dataset is not publicly accessible because: EPA cannot release CBI, or data protected by copyright, patent, or otherwise subject to trade secret restrictions. Request for access to CBI data may be directed to the dataset owner by an authorized person by contacting the party listed. It can be accessed through the following means: Please contact Anne Mikelonis at mikelonis.anne@epa.gov to determine the best path to gaining access to data. Format: This dataset includes pipe information protected by a non-disclosure agreement with the stormwater utility that is protected by a non-disclosure agreement outside of EPA. This dataset is associated with the following publication: Mikelonis, A., J. Shireman, C. Buahin, and K. Ratliff. Repurposing Stormwater Models to Inform Radiological Protective Actions: A Case Study Comparing Radiological Dispersal Device Events Across Two Combined Sewer Systems. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 492(138107): 1-11, (2025).
    0
    4 days ago
  • This spreadsheet contains data about climate assessments published in the United States, including the Fifth National Climate Assessment and sub-national reports published by states, territories, and the District of Columbia. It includes the results of a search for the most recent version of assessment reports published (up until Nov. 2023), content categories applied to assessment chapters, and whether chapters contain theory methods or data from the social sciences, author expertise, and a typology of producing organizations. This dataset is associated with the following publication: Maxwell, K., M. Shacklette, E. Eisenhauer, A. Scheetz, E. Marino, and A. Zycherman. The social sciences in climate assessments in the United States. CLIMATIC CHANGE. Springer, New York, NY, USA, 178(91): 1-20, (2025).
    1
    4 days ago
  • Datasets used to generate figures and sample runs in the SENTINEL application in the journal article "SENTINEL: A Shiny App for Processing and Analysis of Fenceline Sensor Data". This dataset is associated with the following publication: MacDonald, M., W. Champion, and E. Thoma. SENTINEL: A Shiny App for Processing and Analysis of Fenceline Sensor Data. ENVIRONMENTAL MODELLING & SOFTWARE. Elsevier Science, New York, NY, 189: 0, (2025).
    1
    4 days ago
  • This data set includes metrics of growth pertaining to Atlantic corals (Montastraea cavernosa and Stephanocoenia intersepta) exposed to fine-grained, sediment. Data also include bleaching indicators and measurements of sediment-influenced water quality. This dataset is associated with the following publication: Hankins, C., D. White, K. Bahr, Y. Jones, A. Glahn, W. Lehmann, and B. Fisher. Effects of Dredging Induced Resuspension of Fine-Grain Sediment on Two Scleractinian Corals, Montastraea cavernosa and Stephanocoenia intersepta. Journal of Coastal Zone Management. Walsh Medical Media, London, UK, 27(6): 1000650, (2025).
    7
    4 days ago
  • The goal of this study is to determine if there is an association between aerosolized particulate matter (PM) density, wind speed, temperature, humidity, soil-specific parameters, or other site-specific conditions and Coccidioides detection to better understand fungal spore dispersal within the San Joaquin Valley, CA. Soil and filter samples were concurrently collected using an uncrewed aircraft system (UAS) equipped with bioaerosol samplers flown synchronously at multiple heights. Samples were assessed for the presence of Coccidioides spores per the cocciENV assay (Bowers et al, 2019). Collection sites included Bakersfield, CA and surrounding Kern County (39 total), with 767 samples collected using an interrupted radial transect design.
    2
    4 days ago
  • 4 days ago
  • Amplicon sequence variants from benthic and zooplankton samples generated using COI primers
    3
    4 days ago
  • This dataset includes outputs from MSW DST model to generate alternative waste management scenarios for Davenport IA. This dataset is associated with the following publication: Kaplanakman, P., K. Weitz, and S. Thorneloe-Howard. Sustainable and Resilient Solid Waste Infrastructure: Davenport, Iowa Case Study. U.S. Environmental Protection Agency, Washington, DC, USA, 2023.
    2
    4 days ago
  • The study results and data used and produced in this study are available through the Texas Data Repository at https://doi.org/10.18738/T8/A9X5ET (Srinivasan et al., 2023). The data also includes the necessary information to reproduce the figures and tables presented in the study. This dataset is associated with the following publication: Bawa, A., K. Mendoza, R. Srinivasan, F. O'Donncha, D. Smith, K. Wolfe, R. Parmar, J. Johnston, and J. Corona. Enhancing Hydrological Modeling of Ungauged Watersheds through Machine Learning and Physical Similarity-based Regionalization of Calibration Parameters. ENVIRONMENTAL MODELLING & SOFTWARE. Elsevier Science, New York, NY, 186: 106335, (2025).
    1
    4 days ago
  • This SAS dataset contains data on salivary concentrations of selected immune and neuroendocrine biomarkers, as well as socioeconomic and demographic data, self-reported health data, and behavioral data. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: This dataset is available upon request. Eligible researchers can contact study investigators Andrey Egorov (egorov.andrey@epa.gov) or Michael Nye (nye.michale@epa.gov). Format: This dataset contains demographic, socioeconomic, behavioral and stress data on residents of two communities in Denver, CO, as well as data on biomarker levels in saliva. This dataset is associated with the following publication: Egorov, A., W. Xue, J. Kobylanski, M. Fuzawa, S. Griffin, T. Wade, and M. Nye. Pilot application of an inflammation and physiological dysregulation index based on noninvasive salivary biomarkers. BMC Research Notes. BioMed Central Ltd, London, UK, 18: 53, (2025).
    0
    4 days ago
  • This data set represents quantified emissions of NH3 following application of urea-based fertilizer to bare agricultural soil in the Coastal Plain region of North Carolina (NC Department of Agriculture, Cherry Research Station).
    1
    4 days ago
  • The database contains scenarios that were submitted for EMF 37 Deep Decarbonization Study. The data is presented for U.S. scenarios that reach net-zero emissions across the economy by midcentury. The tables and figures in the manuscript utilizes this dataset. This dataset is associated with the following publication: Kaplanakman, O., G. Boyd, M. Browning, K. Perl, S. Supekar, N. Victor, and E. Worrell. Is the Industrial Sector Hard to Decarbonize or Hard to Model? A comparative analysis of Industrial Modeling and Net Zero Carbon Dioxide Pathways. Energy and Climate Change. Elsevier B.V., Amsterdam, NETHERLANDS, 6: 100190, (2025).
    1
    4 days ago
  • Electron microscope image of wood smoke. This dataset is associated with the following publication: Abzhanova, A., J. Berntsen, E. Pennington, L. Dailey, S. Masood, I. George, N. Warren, J. Martin, M. Hays, A. Ghio, J. Weinstein, Y.H. Kim, E. Puckett, and J. Samet. Monitoring Redox Stress in Human Airway Epithelial Cells Exposed to Woodsmoke at an Air-Liquid Interface. Particle and Fibre Toxicology. BioMed Central Ltd, London, UK, 21: 14, (2024).
    2
    4 days ago
  • Polychlorinated biphenyls (PCBs) are a group of 209 chemicals with varying chlorine substitutions that influence their absorption, distribution, metabolism, and excretion (ADME). These differences affect how PCBs behave in the body, including their lipophilicity, tissue distribution, and biological half-life. Humans and animals can absorb PCBs through inhalation, ingestion, or skin contact, with the compounds accumulating in fatty tissues and eliminating at variable rates—some over decades. Pharmacokinetic (PK) models help estimate internal doses and assess health risks by accounting for species-specific ADME properties. However, modeling PCBs is challenging due to their persistence, bioaccumulation, and structural diversity. While PK models can support risk assessment and interspecies extrapolation, they require accurate data—particularly biological half-lives, which are unavailable for many congeners. This study aims to compile half-life data for individual PCB congeners from the literature in support of future explorations of the use of Quantitative Structure Activity Relationship (QSAR) models to predict half-lives of unstudied congeners using structural features like chlorine substitution patterns, building on prior work. Database curation: The HERO PCBs project page (https://hero.epa.gov/hero/index.cfm/project/page/project_id/384) was searched using terms related to half-life or elimination. Studies retrieved by the literature search were screened to identify studies containing PCB congener half-life data. Select details from each relevant study were entered into the database (e.g., citation information, congener name and number, exposure context, population descriptors, biological matrix, and reported half-life).
    1
    4 days ago
  • Estimating the value of changes in water quality requires the definition of biophysical features that link changes in ecosystems to changes in social systems. Those linking features must be interpretable to people and serve as effective ecological indicators. This work defines a linking feature that is appropriate for capturing existence values in a forthcoming national stated preference survey of Clean Water Act regulations. Further, we modeled and spatially predicted this feature to account for the dependence of survey respondents’ preference on baseline aquatic conditions near them. We outline steps to provide insights on the mechanisms that will aid in forecasting changes in the linking feature in responses to candidate policy options.
    4
    4 days ago
  • This dataset provides information on the viability of organotypic approaches in evaluating extracellular vesicles (EVs) to investigate exposure-induced biomarkers and underlying mechanisms. Data include assessments of cell viability, cell permeability, EV imaging, EV count, EV size, and EV proteomics in the H441/IMR90 co culture model exposed to wildfire smoke condensates. All the column headings and other relevant definitions and information are included in the data sets, and match the relevant data in the study that will be published. This dataset is associated with the following publication: Vitucci, E., C. Carberry, A. Payton, L. Herring, A. Mordant, Y.H. Kim, M. Gilmour, S. McCullough, and J. Rager. Wildfire-relevant woodsmoke and extracellular vesicles (EVs): Alterations in EV proteomic signatures involved in extracellular matrix degradation and tissue injury in airway organotypic models. ENVIRONMENTAL RESEARCH. Elsevier B.V., Amsterdam, NETHERLANDS, 264(2): 120395, (2025).
    1
    4 days ago
  • 2011 National Wetland Condition Assessment diatom species data and corresponding site information.
    2
    4 days ago
  • The dataset provides a set of Import Emission Factors (IEF) for USEEIO models developed using the GLORIA v059a model. The dataset accompanies Addendum 2 "Import Greenhouse Gas Emission and Material Factors Derived from GLORIA" to EPA report "Estimating embodied environmental flows in international imports for the USEEIO Model" (https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=362470). The import factors (IFs) are provided for 15 material categories and 18 GHG categories at the BEA summary and detail levels of sector resolution as reflected in file names. They represents an average for U.S imports that is derived as a weighted average of the import factors from all world regions/countries, weighted by quantity of imports. The sector codes for the import factor use the BEA 2017 NAICS based schema used in input-output tables which is the schema used by the associated USEEIO models. For example, US_summary_import_factors_gloria_2022_17sch.csv is a summary level IFs file. US_detail_import_factors_gloria_2022_17sch.csv is the detail level IEFs file. Concordance files are provided here that are used to map GLORIA commodities and countries to those used in USEEIO. The models are named according to an updated USEEIO naming scheme. See the supporting code on the USEEIO github site (link in references) for more details. This dataset is associated with the following publication: Ingwersen, W.W., J. Namovich, B. Young, and J. Vendries. Estimating embodied environmental flows in international imports for the USEEIO Model. U.S. Environmental Protection Agency, Washington, DC, USA, 2024.
    12
    4 days ago
  • Source Code for the manuscript "Characterizing Variability and Uncertainty for Parameter Subset Selection in PBPK Models" -- This R code generates the results presented in this manuscript; the zip folder contains PBPK model files (for chloroform and DCM) and corresponding scripts to compile the models, generate human equivalent doses, and run sensitivity analysis.
    1
    4 days ago
  • These data are an update to 2012-2020 Greenhouse Gas National- and State-Level Emission Totals by Industry (https://doi.org/10.23719/1529805). Data for 2021 and 2022 are added and are aligned with the 2012-2022 National-Level Greenhouse Gas Emission Totals by Industry (https://doi.org/10.23719/1531141). The Excel file contains a sheet with these totals by state and sector and year for each year in the time series along with metadata. Links are provided to the datasets in parquet format as generated by FLOWSA. Supporting metadata for each dataset is provided in the links. The primary emissions source was updated to use the EPA "Inventory of U.S. Greenhouse Gas Emissions and Sinks by State" 2024 report. The industry classifications were updated to use 2017 North American Industry Classification Codes. The code used to generate the datasets is available in the FLOWSA v2.0.5 tool (https://github.com/USEPA/flowsa/tree/v2.0.5). Values are given in total kilograms emitted for the given year, sector and location. Please see the related publication for more background information. https://cfpub.epa.gov/si/si_public_record_Report.cfm?dirEntryId=360507&Lab=CESER Validation: A supporting zip archive (GHG_by_Sector_and_State_2012-2022_validation.zip) is provided with results of various validation checks. Files with the pattern 'GHG_XXXX_rel_state_flow_comparison.csv' where 'XXXX' is the data year show totals by gas in a given year summed across states from this dataset ('state' field) compared to previously published national totals by gas produced from the national totals by industry ('national' field) for the same year. 'comp' is a ratio of 'state':'national'. All other fields are the same as those found in the FLOWSA flow-by-sector data format. Files with the pattern 'GHG_XXXX_rel_state_sector_comparison.csv' where 'XXXX' is the data year show the totals by gas by industry in a given year summed across states by gas and by industry compared to national totals by gas by industry by year. Fields have the same meaning as described above. Additional validation and log files of the associated FLOWSA model runs can be found on the EPA Data Commons (https://dmap-data-commons-ord.s3.amazonaws.com/index.html#flowsa/FlowBySector/) where the parquet and metadata files reside and have the same file names but end in .log and _validation.log. Please read more in the FLOWSA documentation to understand these files. Preferred Citation: Please cite this dataset as Young, Ben, Ingwersen, Wesley. 2025. 2012-2022 State-Level Greenhouse Gas Emission Totals by Industry. Data.gov. https://doi.org/10.23719/1532224. This dataset is associated with the following publication: Young, B., C. Birney, and W.W. Ingwersen. Dataset of 2012-2020 U.S. National- and State-Level Greenhouse Gas Emissions by Sector. Data in Brief. Elsevier B.V., Amsterdam, NETHERLANDS, 53: 110173, (2024).
    12
    4 days ago
  • Biomass, density, leaf area index and plant morphology characteristics as well as tissue C:N:P.
    1
    4 days ago
  • NA. This dataset is not publicly accessible because: The data is not generated by EPA and the single figure contains the data. It can be accessed through the following means: Viewing the manuscript or reaching out to corresponding author. Format: The data is not generated by EPA. Only one figure includes data and the data is clearly shown in a timeline format for illustrative purposes.. This dataset is associated with the following publications: Achtemeier, R., K. Adeem, S. Kutzing, D. Lytle, B. Farrelly, and B. Kearney. Understanding the Success behind Newark, New Jersey’s Lead Service Line Removal Program. U.S. Environmental Protection Agency, Washington, DC, USA. Triantafyllidou, S., L. Wasserstrom, J. Nelson, D. Webb, C. Formal, E. Dore, and D. Lytle. Lead in synthetic and municipal drinking water varies by field versus laboratory analysis. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 891: e163873, (2023).
    0
    4 days ago
  • Seagrass biomass, percent N, percent phosphorus, isotope ratios, and NPI calculations, sediment nutrient data, water column nutrient data.
    1
    4 days ago
  • Excel file containing individual data points for all figures and tables in the manuscript.
    1
    4 days ago
  • Individual sample data for each figure in exscel file. This dataset is associated with the following publication: Alewel, D., S. Gavett, K. Rentschler, M. Schladweiler, C. Miller, P. Evansky, T. Jackson, W. Williams, and U. Kodavanti. Adrenergic receptor subtypes differentially influence acrolein-induced ventilatory, vascular leakage, and inflammatory responses. TOXICOLOGY AND APPLIED PHARMACOLOGY. Elsevier B.V., Amsterdam, NETHERLANDS, 498: 117303, (2025).
    1
    4 days ago
  • Excel file with individual sample data. This dataset is associated with the following publication: Henriquez, A., S. Snow , T. Jackson, J. House, D. Alewel, M. Schladweiler, M. Valdez, D. Freeborn, C. Miller, R. Grindstaff, P. Kodavanti, and U. Kodavanti. Social isolation exacerbates acute ozone inhalation induced pulmonary and systemic health outcomes. TOXICOLOGY AND APPLIED PHARMACOLOGY. Elsevier B.V., Amsterdam, NETHERLANDS, 457: 116295, (2022).
    1
    4 days ago
  • This dataset is a collection of emissions data during extrusion processes used to support regression modeling research. The data were collected from various academic publications and patents. Since the case study involving the data was for demonstrative purposes, the dataset involves some approximations to complete all data fields. Users are encouraged to visit the associated journal article and individual sources to better understand if any parts or all of the data are fit for purpose. This dataset is associated with the following publication: Meyer, D.E., R.L. Smith, E. Lanphear, S. Takkellapati, J.D. Chea, G.J. Ruiz-Mercado, M.A. Gonzalez, and W.M. Barrett. Regression tools for chemical release modeling: An additive manufacturing case study. JOURNAL OF OCCUPATIONAL AND ENVIRONMENTAL HYGIENE. Taylor & Francis, Inc., Philadelphia, PA, USA, 22(5): 375-385, (2025).
    1
    4 days ago
  • This dataset is a collection of .csv's for extracted data from the literature, processing code, and final analysis for manuscript. This dataset is not publicly accessible because: This data is subject to change following peer review. It can be accessed through the following means: This data will be publicly accessible on github once the manuscript is accepted for publication. Format: This is the extracted data, code, and documentation for this manuscript. This dataset is associated with the following publication: Zurlinden, T., M. Dzierlenga, D. Kapraun, C. Ring, A. Bernstein, P. Schlosser, and V. Morozov. Estimation of species- and sex-specific PFAS pharmacokinetics in mice, rats, and non-human primates using a Bayesian hierarchical methodology. TOXICOLOGY AND APPLIED PHARMACOLOGY. Elsevier B.V., Amsterdam, NETHERLANDS, 499: 117336, (2025).
    0
    4 days ago
  • Dataset includes water quality measurements from an urban stream and three municipal separate storm sewer system outfalls. Additional details provided in attached Dataset Description document. “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    2
    4 days ago
  • Dataset describes measurements of host-associated qPCR genetic markers along with other water quality parameters and precipitation from samples collected at marine, estuary, and freshwater recreational sites. Additional details provided in attached Dataset Description document. “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    2
    4 days ago
  • Dataset includes repeated measures of the National Institute of Standards and Technology Standard Reference Material 2917 (SRM 2917) using an Enterococcus digital PCR (dPCR) assay. “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    2
    4 days ago
  • In this dataset, we present data on PFAS measured using nontargeted methods in American Healthy Homes Study (AHHS) II residential tap water. Residential drinking water samples were collected as part of the American Healthy Homes Survey (AHHS) II effort by HUD for surveillance of chemicals of concern. Previous analysis was conducted on the collected media to account for lead, but the stability of PFAS enables follow-up analysis even after lead processing. PFAS were analyzed in ~800 water samples using non-targeted analysis by mass spectrometry. Because the methods are nontargeted and thus performed without prior knowledge of the identity of the PFAS in the sample, values are reported as instrument response integrated areas. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: Data presented in this manuscript is available upon reasonable request by contacting the authors, but locations may be censored to protect confidentiality of study participants. Format: EPA’s Office of Research and Development (ORD) was not directly engaged in the collection of information from human subjects. HUD’s contractor, QuanTech, conducted the field study and collected tap water and house dust samples. QuanTech received IRB Approval CR00077983 for HUD OHHLHC - AHHS II, American Healthy Homes Survey (AHHS) II (Pro00019737). According to the requirements of EPA Order 1000.17 A (Policy and Procedures on Protection of Human Research Subjects) and EPA Regulation 40 CFR 26 (Protection of Human Subjects), it was determined that the EPA investigators were not engaged in human subjects research (HSR-001225). This dataset is associated with the following publication: Boettger, J., N. Deluca, M. Zurek-Ost, K. Miller, C. Fuller, K. Bradham, P. Ashley, W. Friedman, E. Pinzer, D. Cox, G. Dewalt, K. Isaacs, E. Cohen-Hubal, and J. McCord. Emerging Per- and Polyfluoroalkyl Substances in Tap Water from the American Healthy Homes Survey II. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(5): 2686–2698, (2025).
    0
    4 days ago
  • Pedigree of all data and processing included in the manuscript. Open zip file then access pedigree folder for file describing all other folders, links, and data dictionary Items: NOTES: Description of work and other worksheets. Pedigree: Summary source files used to create figures and tables. DataFiles: Data files used in the R code for creating the figures and tables. DataDictionary: Data file titles in all data files Data: Data file uploaded to Science Hub Output: Files generated from R scripts Plot: Plots generated from R scripts and other software R_Scripts: Clean R scripts used to analyze the data, generate figures and tables Result: Tables generated from R scripts
    1
    4 days ago
  • DNA metabarcoding data as raw DNA sequences from the DNA sequencing instrument along with spreadsheets of data generated from bioinformatic analyses of the raw data. “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    2
    4 days ago
  • Amplicon sequence variants from enrichment cultures and non-enriched water samples generated with primer sets targeting the V4 region of the 16SrRNA. “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    3
    4 days ago
  • Amplicon sequence variants from enrichment cultures and non-enriched water samples generated with primer sets targeting the V4 region of the 16SrRNA “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”
    2
    4 days ago
  • PFAS Data for Municipal Impact from residential pump stations and septage. This dataset is associated with the following publication: Penrose, M., J. Deighton, S.T. Glassmeyer, A. Brougham, S.M. Bessler, T. McKnight, and M. Ateia. Elevated PFAS Precursors in Septage and Residential Pump Stations. Environmental Science & Technology Letters. American Chemical Society, Washington, DC, USA, 12(4): 454-460, (2025).
    1
    4 days ago
  • Data for opportunistic pathogen detections and physicochemical parameters in drinking water. This dataset is associated with the following publication: Zhang, C., N. Sienkiewicz, I. Struewing, J. Mistry, H. Buse, Z. Hu, and J. Lu. Reconsider the burn: The transient effect of a chlorine burn on controlling opportunistic pathogens in a full-scale chloraminated engineered water system. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 933: 172690, (2024).
    1
    4 days ago
  • These data represent an update to the dataset, "State IO Two-Region Economic Input-Output Models for 50 U.S. States 2012-2017" based on the methods described by Li et al. (2022). They are an update to that dataset published with an expanded time series. These models were produced with the stateior R package, v0.4.0. Excel files (50 in total) are provided for two region (State of Interest and Rest of U.S.) Make and Use tables for each U.S. State IO model for years 2012-2023. Additional data files supporting this release including all intermediate and final products in native R format (.RDS) and can be opened directly in R software or through the stateior package. See the stateior github page for more details. https://dmap-data-commons-ord.s3.amazonaws.com/index.html#stateio/ All values are in current dollar years (e.g "Make 2012" is the Make table in 2012 USD in a given model). For a description of the methods used and survey of results see the Addendum 1 on the EPA Science Inventory page for the original publication. Please cite this dataset as: Young, Ben, Julie Chen, Jorge Vendries, and Wesley Ingwersen. 2025. “StateIO v0.4.0 Two-Region Economic Input-Output Models for 50 U.S. States: 2012-2023.” Data.gov. https://doi.org/10.23719/1532211. This dataset is associated with the following publication: Li, M., J. Ferreira, C.D. Court, D. Meyer, M. Li, and W.W. Ingwersen. StateIO - Open Source Economic Input-Output Models for the 50 States of the United States of America. International Regional Science Review. SAGE Publications, THOUSAND OAKS, CA, USA, 46(4): 428-481, (2023).
    51
    4 days ago
  • This includes the ozone formation characterization factors that were developed for TRACI 3. The base model was built with a more comprehensive set of substances found in the SAPRC model.
    1
    4 days ago
  • Dataset is linked information on sudden death in Wake County NC with air pollution concentrations from central site monitor. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: SUDDEN data can be requested through the UNC PI, Dr. Ross Simpson. Air pollution data can be accessed through the AQS data mart. Greenspace metrics can be acquired through the National Land Cover Land Use database. Format: Datasets are in csv and SAS formats. This dataset is associated with the following publication: Rappazzo, K., N. Egerstrom, J. Wu, A. Capone, G. Joodi, S. Keen, W. Cascio, and R. Simpson, Jr. Fine particulate matter-sudden death association modified by ventricular hypertrophy and inflammation: a case-crossover study. Frontiers in Public Health. Frontiers, Lausanne, SWITZERLAND, 12: 1367416, (2024).
    0
    4 days ago
  • This dataset consists of various USEEIO v2.5 models. All models are built using the coupled model approach described in the EPA 2024 report "Estimating embodied environmental flows in international imports for the U.S. Environmentally-Extended Input-Output (USEEIO) Model" and using the v1.7.0 release of useeior. Models are named using an alias that corresponds with a unique set of model attributes, and the final two digits represent the last two digits of the year intended to be represented. Model alias attributes are defined at https://github.com/USEPA/USEEIO/blob/master/models.md#aliases. Catbird and oriole are detailed and summary-level models, respectively, coupled with CEDA 2024 for representing GHGs in imports. Kinglet and kingbird are detailed and summary-level models, respectively, coupled with EXIOBASE v3.8.2 for representing GHGs in imports. Waxwing and yellowthroat are detailed and summary-level models, respectively, coupled with the GLORIA v59a model for representing GHGs and material flows in imports. The summary level models are available for 2017-2022 for EXIOBASE- and GLORIA-coupled models and 2022 for the CEDA-coupled model. The detailed CEDA, EXIOBASE and GLORIA coupled models are only available for 2022 (note underlying U.S. IO data represents 2017 for detailed models). "v2.5-kingbird-" models replace "v2.3-s-GHG-" models, published under "USEEIO Models with Import Emission Factors for Greenhouse Gases for 2017-2022 from EXIOBASE coupled model". "v2.5-oriole-22" replaces "v2.4-oriole-22" , published under "USEEIO Models with Import Emission Factors for Greenhouse Gases for 2022 from CEDA coupled model". The model objects are in unique tabs/worksheets of each file and defined in https://github.com/USEPA/useeior/blob/v1.7.0/format_specs/Model.md. Links to the model specification files are provided below. More information can be found on these models in two additions to the original EPA report "Estimating embodied environmental flows in international imports for the USEEIO Model" https://cfpub.epa.gov/si/si_public_record_report.cfm?dirEntryId=362470. The "Corrigendum: Updated Results for Consumption-based GHG Emissions" describes updates related to the EXIOBASE and CEDA coupled models. Addendum 2 describes the GLORIA coupled models. Please cite this dataset as "Young, Ben, and Wesley Ingwersen. 2025. USEEIO v2.5 Models. Data.gov. https://doi.org/10.23719/1532178.". This dataset is associated with the following publication: Ingwersen, W.W., J. Namovich, B. Young, and J. Vendries. Estimating embodied environmental flows in international imports for the USEEIO Model. U.S. Environmental Protection Agency, Washington, DC, USA, 2024.
    16
    4 days ago
  • data for manuscript titled "Smartphone Application (TracMyAir) for Modeling Exposures to PM2.5 and Ozone – Integration with Air Quality Networks and Location-Activity Sensors" by M. Breen, V. Isakov, et al. This dataset is associated with the following publication: Breen, M., V. Isakov, C. Seppanen, S. Arunachalam, M. Breen, S. Prince, T. Long, D. Heist, P. Deshmukh, K. Appel, C. Hogrefe, B. Murphy, C. Nolte, R. Owen, G. Pouliot, H. Pye, and J. Rosati Rowe. TracMyAir smartphone application for modeling exposures to PM2.5 and ozone – Integration with air quality networks and location-activity sensors. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 959: 178200, (2025).
    14
    4 days ago
  • These are hydrometeorological datasets obtained from US national data repositories as inputs to a hydrologic model and model simulations over the St. Joseph River Watershed (SJRW) for both gauged and hypothetical ungauged scenarios. The datasets purpose is to demonstrate the applicability of the machine learning-based Limits of Acceptability (LoA) method and hydrologic signatures to evaluate the Sacramento Soil Moisture Accounting (SAC-SMA). This dataset is associated with the following publication: Gupta, A., M.M. Hantush, and R.S. Govindaraju. Evaluation of hydrological models at gauged and ungauged basins using machine learning-based limits-of-acceptability and hydrological signatures. JOURNAL OF HYDROLOGY. Elsevier Science Ltd, New York, NY, USA, 641: 131774, (2024).
    8
    4 days ago
  • Data set generated in collaboration with Dr Andy Lamb from Aerodyne Inc. Portions of this dataset are inaccessible because: Non-EPA-owned by Aerodyne Inc. They can be accessed through the following means: Contact Dr Andy Lamb from Aerodyne Inc. at: lambe@aerodyne.com/. Format: Data format, size, if special instruments /software is needed to read the data. This dataset is associated with the following publication: Lambe, A., C. Glenn, A. Avery, T. Xu, J.C. Ditto, M. Canagaratna, D. Gentner, K. Docherty, M. Jaoui, J. Zaks, A.K. Bertram, N.L. Ng, and P. Liu. Gas-Phase Nitrate Radical Production Using Irradiated Ceric Ammonium Nitrate: Insights into Secondary Organic Aerosol Formation from Biogenic and Biomass Burning Precursors. ACS Earth and Space Chemistry. American Chemical Society, Washington, DC, USA, 9(3): 545-559, (2025).
    3
    4 days ago
  • These are auxiliary data that complement the dataset associated with subproduct SSWR.401.1.2.24 and can be used to further explore and expand approaches and applications developed therein. (SSWR.401.1.2.24: Using DNA metabarcoding to characterize national scale diatom-environment relationships and to develop indicators in streams and rivers of the United States)
    1
    4 days ago
  • Monitoring data from Minnesota and from national surveys of lakes and streams that were used in the analysis for the paper: Predicting lake chlorophyll from stream phosphorus concentrations. mod.mn.R.txt: R script for fitting TP-Chl model using Minnesota data mod.nat.R.txt: R script for fitting TP-Chl model using national data dat.nat.1.csv: National stream TP data dat.nat.2.csv: National lake Chl data dat.mn.1.csv: Minnesota lake Chl data dat.mn.2.csv: Minnesota stream TP data. Citation information for this dataset can be found in Data.gov's References section.
    4
    4 days ago
  • The U.S. Environmental Protection Agency characterized sediments and seeps/springs in the San Juan watershed located in southwestern Colorado and the four corners region of Colorado, New Mexico, Arizona, and Utah (western United States). The Datasets contain field and laboratory data that resulted from that sampling. Samples for this project were collected from 2018 to 2021. Results of new Pb isotope ratio measurements are provided for sediments (n = 96) collected from across the watershed and seeps/springs (n = 73) from the mineralized headwaters region of the watershed. The Microsoft Excel spreadsheets contain sample data and Quality Control data, including results of primary standards, second source standards, and sample duplicate analyses.
    2
    4 days ago
  • MCSimMod is a flexible and efficient R package that can be used for implementation and application of physiologically based pharmacokinetic (PBPK) and other ordinary differential equation (ODE) models.
    1
    4 days ago
  • Data set contains sensitive PII and cannot be released publicly. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: contact Tim Wade (wade.tim@epa.gov). Format: Data include personally identifiable information collected from living individuals. This dataset is associated with the following publication: Wade, T., A. Cohen, M. Raseduzzaman, B. O'Connell, T. Brown, T. Mami, L. Krometis, A. Hubbard, P. Scheuerman, M. Edwards, A. Darling, B. Pennala, S. Price, B. Lytton, E. Whettstone, S. Pholwat, S. Griffin, J. Kobylanski, and A. Egorov. Drinking Water Sources, Quality, and Associated Health Outcomes in Appalachian Virginia: A Risk Characterization Study in Two Counties. ENVIRONMENTAL HEALTH. BioMed Central Ltd, London, UK, 260: 114390, (2024).
    0
    4 days ago
  • Full dataset for "Factors affecting reduction of infectious aerosols by far-UVC and portable HEPA air cleaners". This dataset is associated with the following publication: Ratliff, K.M., L. Oudejans, M.W. Calfee, J. Archer, J.U. Gilberry, D.A. Hook, W.E. Schoppman, and R.W. Yaga. Factors affecting reduction of infectious aerosols by far-UVC and portable HEPA air cleaners. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 2(3): 368-377, (2025).
    1
    4 days ago
  • Input csvs containing P and N inventories by HUC8, kgPN from fire retardants per HUC8 x year R code for compiling and matching inputs Output csvs for comparing fire retardant P to P deposition and fire retardant N to N deposition. This dataset is associated with the following publication: Moorhead, L.C., M.J. Pennino, R.D. Sabo, and S.D. LeDuc. Fire Retardants Are an Overlooked Source of Phosphorus to Western US Ecosystems. ACS ES&T Water. American Chemical Society, Washington, DC, USA, 5(4): 1620-1627, (2025).
    1
    4 days ago
  • This data dictionary describes relevant fields from secondary data sources that can assist with modeling the conditions of use for a chemical when performing a chemical assessment. Information on how to access the secondary data sources are included. This dataset is associated with the following publication: Chea, J.D., D.E. Meyer, R.L. Smith, S. Takkellapati, and G.J. Ruiz-Mercado. Exploring automated tracking of chemicals through their conditions of use to support life cycle chemical assessment. JOURNAL OF INDUSTRIAL ECOLOGY. Berkeley Electronic Press, Berkeley, CA, USA, 29(2): 413-616, (2025).
    1
    4 days ago
  • Maricopa County partnered with EPA Office of Research and Development to evaluate the utility of sensors to capture wood burning episodes. For this study, PM2.5 sensors were collocated at three air quality monitoring stations within this targeted geographic area. Namely, Durango Complex, West Phoenix, and South Phoenix (designated as DC, WP and SP) for a period of 2 years to better understand sensor performance, comparability with regulatory grade monitors, and to explore drift and changes in performance over time. Approximately 6 months later, phase II began a year+ field study using sensors in a distributed network with FRM/FEM monitors to measure PM2.5 to characterize the impact of local air pollution sources—targeting the wintertime heating season in which wood combustion is the principal air pollutant source of interest; other sensors to be deployed during Phase II include black carbon sensors. The Zenodo link provides raw PM2.5 data collected as part of the P-TAQS study from these PurpleAir sensors and reference instruments deployed at fixed sites at 1-minute time resolution ordered by site and date/time. This ScienceHub entry contains the processed data files used to create the Figures in the manuscript titled "Seasonal Effects in the Application of the MOMA Remote Calibration Tool to Outdoor PM2.5 Air Sensors"
    10
    4 days ago
  • This dataset presents a rich collection of physicochemical parameters from 147 reservoirs distributed across the conterminous U.S. One hundred and eight of the reservoirs were selected using a statistical survey design and can provide unbiased inferences to the condition of all U.S. reservoirs. These data could be of interest to local water management specialists or those assessing the ecological condition of reservoirs at the national scale. These data have been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for publication. This dataset is not publicly accessible because: It is too large. It can be accessed through the following means: https://portal-s.edirepository.org/nis/mapbrowse?scope=edi&identifier=2033&revision=1. Format: This dataset presents water quality and related variables for 147 reservoirs distributed across the U.S. Water quality parameters were measured during the summers of 2016, 2018, and 2020 – 2023. Measurements include nutrient concentration, algae abundance, dissolved oxygen concentration, and water temperature, among many others. Dataset includes links to other national and global scale data sets that provide additional variables.
    0
    4 days ago
  • Data processing was conducted using the Anaconda distribution of Python 3.9 and associated libraries. Jupyter notebooks are available at https://github.com/patlewig/nts_pfas. Datasets supporting the manuscript are accessible at https://doi.org/10.23645/epacomptox.26524327. This dataset is associated with the following publication: Patlewicz, G., R. Judson, A. Williams, T. Butler, S. Barone, K. Carstens, J. Cowden, J. Dawson, S. Degitz, K. Fay, A. Lowit, S. Padilla, K. Friedman, M. Phillips, D. Turk, J. Wambaugh, B. Wetmore, and R. Thomas. Development of chemical categories for per- and polyfluoroalkyl substances (PFAS) and the proof-of-concept approach to the identification of potential candidates for tiered toxicological testing and human health assessment. Computational Toxicology. Elsevier B.V., Amsterdam, NETHERLANDS, 31: 100327, (2024).
    5
    4 days ago
  • Stream condition index and water quality data from Virgina Department of Environmental Quality and landscape metrics from EPA's Stream Catchment dataset.
    1
    4 days ago
  • Amplicon sequence variants from benthic and zooplankton samples generated using COI primers This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”"
    3
    4 days ago
  • Amplicon sequence variants from ballast water samples generated with primer sets targeting 18S and COI loci “This research dataset has been reviewed in accordance with U.S. Environmental Protection Agency (U.S. EPA), Office of Research and Development, and approved for release. Mention of brand names or vendors does not constitute an endorsement of products or services by the U.S. EPA.”"
    3
    4 days ago
  • 4 days ago
  • Data set includes measurements used in Figure 2.
    1
    4 days ago
  • This map shows high-resolution (1 meter) land cover in the EPA Region 3, covering the parts of West Virginia, Virginia, and Pennsylvania outside of the Chesapeake Bay Watershed. It contains the following classes: Water, Tree Canopy, Scrub\Shrub, Low Vegetation, Barren, Impervious Structures, Other Impervious, Impervious Roads, Tree Canopy Over Impervious Structures, Tree Canopy Over Other Impervious, and Tree Canopy Over Impervious Roads. Using object-based image analysis mapping techniques, it was mapped from a combination of remote-sensing imagery and GIS datasets, including LiDAR, multispectral imagery, and thematic layers (e.g., roads, building footprints). Draft output was then manually reviewed and edited to eliminate obvious errors of omission and commission. The classification scheme closely follows a similar mapping effort for the Chesapeake Bay Watershed; together, maps from the two projects cover the entirety of the EPA Region 3 states. One difference between the projects, however, is that tidal wetlands were mapped in the Chesapeake Bay effort, included as the class Emergent Wetlands, but not in the EPA Region 3 zones outside of the watershed. The map is considered current as of 2020 for West Virginia, 2021 for Virginia, and 2022 for Pennsylvania.
    1
    4 days ago
  • Data from "Episodic ozone exposure in Long-Evans rats has limited effects on cauda sperm motility and non-coding RNA populations". This dataset is associated with the following publication: Chorley, B., G. Klinefelter, G. Nelson, L. Strader, H. Nguyen, M. Schladweiler, G. Palmer, M. Moore, R. Grindstaff, W. Padgett, G. Carswell, A. Astriab Fisher, U. Kodavanti, J. Dye, and C. Miller. Episodic ozone exposure in Long-Evans rats has limited effects on cauda sperm motility and non-coding RNA populations.. REPRODUCTIVE TOXICOLOGY. Elsevier Science Ltd, New York, NY, USA, 128: 108631, (2024).
    1
    4 days ago
  • Salinity data synthesized and summarized from both EPA and USGS publicly available data. This dataset is associated with the following publication: Kaushal, S., S. Shelton, P. Mayer, B. Kellmayer, R. Utz, J. Reimer, J. Baljunas, S. Bhide, A. Mon, B. Rodriguez-Cardona, S. Grant, T. Newcomer Johnson, J. Malin, R. Shatkay, D. Collison, K. Papageorgiou, J. Escobar, M. Rippy, G. Likens, R. Najjar, A. Mejia, A. Lassiter, M. Li, and R. Chant. Freshwater Faces a Warmer and Saltier Future from Headwaters to Coasts: Climate Risks, Saltwater Intrusion, and Biogeochemical Chain Reactions. BIOGEOCHEMISTRY. Springer, New York, NY, USA, 168: 31, (2025).
    1
    4 days ago
  • Data set includes measurements used to generate Figures 1, 2, 3, and 4.
    1
    4 days ago
  • The fitted filtration efficiency of the most commonly worn disposable respirators and ear loop masks as measured using condensation particle counters.
    1
    4 days ago
  • This dataset contains information regarding disposable mask usage and behaviors in theoretical scenarios where an individual is exposed to air pollution and air quality emergencies. It also contains information on self-assessed craniofacial size, an important determinant of mask efficiency.
    1
    4 days ago
  • This dataset comprises craniometric and anthropometric dimensions from over 300 participants collected as part of the FACEFIT and FACEFIT2.0 projects. This data was collected and compiled according to ISO #7250-1 and 15535 using a 3D camera and standard calipers.
    1
    4 days ago
  • This code is used to calculate fitted filtration efficiency of disposable respiratory protection as measured by the difference between particulate counts in ambient vs. "behind mask" air sampled using condensation particulate counters.
    1
    4 days ago
  • Water stable isotope ratios (2H and 18O) from the Willamette River Basin in Oregon, USA. Isotope values in the Willamette River are from both Portland and Corvallis Oregon, and were collected once or twice a month for 13 years (2011 - 2013). Isotope data are provided for small spatially distributed watersheds across the basin and samples were collected once a year during summer lowflow, and used to test the temporal stability of the Willamette River Basin Isoscape developed in the following paper: Brooks, J. R., Wigington, P. J., Phillips, D. L., Comeleo, R., & Coulombe, R. (2012). Willamette River Basin surface water isoscape (d18O and d2H): temporal changes of source water within the river. Ecosphere, 3(5), 39. doi: http://dx.doi.org/10.1890/ES11-00338.1 In addition, precipitation isotopes from Corvallis and Newport were collected weekly.
    2
    4 days ago
  • Metadata for GAPDH inhibition mediated by thiol oxidation in human airway epithelial cells exposed to an environmental peroxide
    1
    4 days ago
  • The data consists of tables extracted from the National Health and Aging Trends Study (NHATS). The data contains residential history, environmental exposures, disease diagnoses, demographics, and income. This dataset is not publicly accessible because: This data is not owned by the EPA and cannot be posted publicly as it contains PII. It can be accessed through the following means: The data can be accessed by contacting the corresponding author for the study (Dr. Aisha Dickerson). Format: The data consists of tables extracted from the National Health and Aging Trends Study (NHATS). The data contains residential history, environmental exposures, disease diagnoses, demographics, and income.
    0
    4 days ago
  • This dataset contains saturated fatty acid, ambient PM2.5 and RBC mitochondria data. This dataset is associated with the following publication: Shen, W., H. Chen, C. Shih , J. Samet, and H. Tong. Modulatory Effects of Dietary Saturated Fatty Acids on Platelet Mitochondrial Function Following Short-Term Exposure to Ambient Particulate Matter (PM2.5). JOURNAL OF TOXICOLOGY AND ENVIRONMENTAL HEALTH - PART A: CURRENT ISSUES. Taylor & Francis, Inc., Philadelphia, PA, USA, 187(5): 215-226, (2023).
    1
    4 days ago
  • Health and exposure data. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. EPA cannot release CBI, or data protected by copyright, patent, or otherwise subject to trade secret restrictions. Request for access to CBI data may be directed to the dataset owner by an authorized person by contacting the party listed. It can be accessed through the following means: For access to the data please reach out to the corresponding author. Format: The data is owned by the California Department of Public Health. This dataset is associated with the following publication: Rosenberg, A., S. Hoshiko, J.R. Buckman, K.R. Yeomans, T. Hayashi,, S.J. Kramer, S. Huang, N.H.F. French, and A. Rappold. Health Impacts of Future Prescribed Fire Smoke: Considerations From an Exposure Scenario in California. Earth’s Future. John Wiley & Sons, Inc., Hoboken, NJ, USA, 12(2): e2023EF003778, (2024).
    0
    4 days ago
  • This information comes from the dataset README covering the NTA data and associated metadata for this dataset. Dust samples were collected from home vacuum bags and sieved (<150 µm). Internal standard (MPFAC-MXA, Wellington Labs) was spiked , dependent on dust mass, to a concentration of 10 ng/g. Native standards (PFAC-MXA in methanol, Wellington Labs) were dosed into each calibration and QC standard. The next day, 5 ml methanol was added to each sample. Samples were sonicated, centrifuged, and cleaned up. Samples were then blown down using a dry nitrogen gas stream not to dryness; samples were reconstituted to 0.5 ml with methanol as needed. A 100 µl aliquot of sample extract was combined with 300 µl mobile phase A (see below). Sample extracts were analyzed by UHPLC-MS/MS on a Thermo Scientific (Waltham, MA) system consisting of a TriPlus RSH autosampler/injector, Vanquish Horizon UPLC/pump system, and Thermo Orbitrap Fusion tribrid mass spectrometer. Chromatographic separation was performed using a Restek (Bellefonte, PA) Raptor C18 column at 55 °C. A 15-minute reverse-phase gradient was applied consisting of mobile phases A (95:5 v/v deionized water:methanol containing 2.5 mM ammonium acetate) and B (5:95 v/v deionized water:methanol containing 2.5 mM ammonium acetate). Negative-polarity electrospray ionization [ESI (-)] was applied first, with positive-polarity applied afterwards. Mass spectra were collected using a resolving power of 50,000, with preferred-ion data-dependent acquisition (DDA) applied to select molecular features for MS2 fragmentation. Samples were analyzed in a single batch. The full batch was repeated twice with randomized sample order. Separate batches were run for ESI(+) and ESI(-) analysis, for a total of six sample batches. Targeted methanolic calibration standards at concentrations of 1-1000 ng/g Wellington PFAC-MXA PFAS mixture were run at the start and end of the first batch. Method blanks, QC standards, pooled samples, and solvent-only blanks were run every ten samples across all batches. After data collection, chromatograms were processed and peak areas integrated in Thermo Scientific Xcalibur Quan Browser 4.3 for targeted quantitation. For nontargeted identification, chromatograms and associated mass spectra were processed in Thermo Scientific Compound Discoverer 3.3. Features were prioritized for expert identification based on a combination of high maximum abundance, strong match to library spectra, negative mass defect (for PFAS), presence as a member of a likely hologous series (for PFAS and surfactants); and/or presence of diagnostic PFAS-related fragments in their MS2 spectra. Overall, 742 features of interest at confidence 1-3 were identified, as well as 7 confidence-5 features meriting inclusion in the final dataset, and excluding hundreds of features representing false positives/adducts/etc. tentatively identified by Compound Discoverer.
    1
    4 days ago
  • This information comes from the dataset README covering the NTA data and associated metadata for this dataset. Dust samples were collected from home vacuum bags and sieved (<150 µm). Internal standard (MPFAC-MXA, Wellington Labs) was spiked , dependent on dust mass, to a concentration of 10 ng/g. Native standards (PFAC-MXA in methanol, Wellington Labs) were dosed into each calibration and QC standard. The next day, 5 ml methanol was added to each sample. Samples were sonicated, centrifuged, and cleaned up. Samples were then blown down using a dry nitrogen gas stream not to dryness; samples were reconstituted to 0.5 ml with methanol as needed. A 100 µl aliquot of sample extract was combined with 300 µl mobile phase A (see below). Sample extracts were analyzed by UHPLC-MS/MS on a Thermo Scientific (Waltham, MA) system consisting of a TriPlus RSH autosampler/injector, Vanquish Horizon UPLC/pump system, and Thermo Orbitrap Fusion tribrid mass spectrometer. Chromatographic separation was performed using a Restek (Bellefonte, PA) Raptor C18 column at 55 °C. A 15-minute reverse-phase gradient was applied consisting of mobile phases A (95:5 v/v deionized water:methanol containing 2.5 mM ammonium acetate) and B (5:95 v/v deionized water:methanol containing 2.5 mM ammonium acetate). Negative-polarity electrospray ionization [ESI (-)] was applied first, with positive-polarity applied afterwards. Mass spectra were collected using a resolving power of 50,000, with preferred-ion data-dependent acquisition (DDA) applied to select molecular features for MS2 fragmentation. Samples were analyzed in a single batch. The full batch was repeated twice with randomized sample order. Separate batches were run for ESI(+) and ESI(-) analysis, for a total of six sample batches. Targeted methanolic calibration standards at concentrations of 1-1000 ng/g Wellington PFAC-MXA PFAS mixture were run at the start and end of the first batch. Method blanks, QC standards, pooled samples, and solvent-only blanks were run every ten samples across all batches. After data collection, chromatograms were processed and peak areas integrated in Thermo Scientific Xcalibur Quan Browser 4.3 for targeted quantitation. For nontargeted identification, chromatograms and associated mass spectra were processed in Thermo Scientific Compound Discoverer 3.3. Features were prioritized for expert identification based on a combination of high maximum abundance, strong match to library spectra, negative mass defect (for PFAS), presence as a member of a likely hologous series (for PFAS and surfactants); and/or presence of diagnostic PFAS-related fragments in their MS2 spectra. Overall, 742 features of interest at confidence 1-3 were identified, as well as 7 confidence-5 features meriting inclusion in the final dataset, and excluding hundreds of features representing false positives/adducts/etc. tentatively identified by Compound Discoverer.
    1
    4 days ago
  • Data contains various indicators of vulnerability to wildfire smoke exposure and health effects. This dataset is associated with the following publication: Jung, J., J.L. Wilkins, C.L. Schollaert, Y.J. Masudae, J.C. Flunkerd, R.E. Connolly, S.M. D’Evelynd, E. Bonilliab, A. Rappold, R.D. Haugo, M.E. Marlierf, and J.T. Spector. Advancing the Community Health Vulnerability Index for Wildland Fire Smoke Exposure. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 906: 167834, (2024).
    1
    4 days ago
  • Mammalian In vitro bioassay results for associated manuscript-Exposures and potential health implications of contaminant mixtures in linked source water, pre-distribution, and service-area tapwater from public-supply drinking water systems in Minneapolis/St Paul area, USA. This dataset is associated with the following publication: Smalling, K., P. Bradley, K. Romanok, S. Elliot, J. de Lambert, M. Focazio, S. Gordon, J. Gray, L. Kanagy, M. Hladik, K. Loftin, R.B. McCleskey, E. Medlock Kakaley, M. Cardon, N. Evans, and C. Weis. Exposures and potential health implications of contaminant mixtures in linked source water, finished drinking water, and tapwater from public-supply drinking water systems in Minneapolis/St. Paul area, USA. Environmental Science: Water Research & Technology. Royal Society of Chemistry, Cambridge, UK, 9: 1813-1828, (2023).
    1
    4 days ago
  • Data extracted from included studies in systematic review of degradation of aesthetics and human health. This dataset is associated with the following publication: Slawsky, E., J. Hoffman, K. Cowan, and K. Rappazzo. Beneficial Use Impairments, Degradation of Aesthetics, and Human Health: A Review. International Journal of Environmental Research and Public Health. Molecular Diversity Preservation International, Basel, SWITZERLAND, 19(10): 6090, (2022).
    1
    4 days ago
  • This dataset contains the rubric for data extraction for all papers considered for a systematic review of health impacts of improved cookstove technology trials in sub-Saharan Africa. This dataset is associated with the following publication: Dillon, D., S. Reigh, K. Rappazzo, T. Luben, and A. Weaver. A Systematic Review and Meta-Analysis Assessing the Impact of Improved Cookstove Technology Trials (ICTs) on Household Air Pollution and Human Health in Sub-Saharan Africa. Current Environmental Health Reports. Springer International Publishing AG, Cham (ZG), SWITZERLAND, 12: 8, (2025).
    1
    4 days ago
  • This dataset contains final data for the manuscript titled "Comparing short-term volatile organic compound measurements in fenceline environments using multiple mobile air monitoring platforms and methods", Coughlin et al. This dataset and manuscript describes a two-week field campaign where a team cross-compared air monitoring instrumentation in a mobile monitoring format. The scripts included in the data repository process raw data, generate visualizations, and compare measurements from various instruments including a PTR-ToF-MS, UV-DOAS, GC-MS, and SIFT-MS. Different sampling resolutions are handled within the scripts using rolling averages The Methods and Materials within the article describes the monitoring instrumentation that was used and the sampling methodology. A description of the variables in each column of the data files is contained in the file "metadata.xlsx" Auto GC Clean_final.xlsx: Cleaned Automated GC data for analysis from the MDNR site. Canister-PTRMS Comparison_final.xlsx: Data for comparing Canister and PTR-ToF-MS measurements. Canister_final.xlsx: Summary data from canister measurements analyzed by an offline GC-MS. DUVAS_BEN_reprocessed_final.xlsx: Reprocessed UV-DOAS data for comparison. Location_summary.xlsx: Summary of PTR-ToF-MS concentrations during canister collections. monoterpene_final.xlsx: Monoterpene concentration data for interference analysis. PTRMS-GMAP Comparison_final.xlsx: PTRMS and GMAP comparison data from different facilities. PTRMS_canister_stats_summary.csv: Processed summary of PTRMS Canister data. PTRMS_canister_stats_summary_final.csv: Final processed statistics for PTRMS Canister data. PTRMS_concentration_gps_final.xlsx: Joined PTRMS concentration and GPS data. PTRMS_GPS_final.xlsx: Finalized GPS data for PTRMS analysis. siftms_mz_45_comparison_final.xlsx: Data for comparing SIFT-MS at for potential acetaldehyde/EtO interference. This dataset is associated with the following publication: Coughlin, J., A. Tasoglou, K. Haile, L. Silva, S. Hamilton, M. Fuoco, S. Porter, A. Liangou, and E. Thoma. Comparing short-term volatile organic compound measurements in fenceline environments using multiple mobile air monitoring methods. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 2(3): 295–308, (2025).
    16
    4 days ago
  • Tillamook Estuary, OR continuous water quality monitoring dataset: 2017-2023
    1
    4 days ago
  • Datasets for adsorption and desorption PFAS experiments run to compare novel adsorbents. Water quality of retentates and scrubber waters are also included. This dataset is associated with the following publication: Butzlaff, A.H., B. Mezgebe, A. Collins, Z. Lin, D. Lassalle-Vega, I.M. Harmody , O. Coronell, F.A. Leibfarth, W.R. Dichtel, M. Nadagouda, and M. Ateia. Comparative evaluation of PFAS-selective adsorbents in hard-to-treat residual waste streams. Chemical Engineering Journal. Elsevier BV, AMSTERDAM, NETHERLANDS, 511: 161983, (2025).
    2
    4 days ago
  • Passive and active VOC measurements were collected weekly for 15 months between December 2020 and April 2022 at the Fairbanks, AZ site. Various indicators and tracers (I&T), including indoor radon, differential pressure, temperature, and other environmental factors, were also collected. Results from this study help clarify the factors that influence temporal trends in VOC concentrations across multiple sampling zones in commercial buildings in a subarctic climate zone and thus inform vapor intrusion sampling strategies. This dataset is associated with the following publication: Zimmerman, J., A. Williams, B. Schumacher, C. Lutes, R. Warrier, B. Cosky, B. Thompson, C. Holton, and K. Bronstein. Impact of Multiple HVAC Systems on Indoor Air VOC and Radon Concentrations from Vapor Intrusion During Seasonal Usage. ATMOSPHERE. MDPI, Basel, SWITZERLAND, 16(4): 378, (2025).
    1
    4 days ago
  • This dataset provides information on home sale prices, parcel characteristics, distance of parcels to contaminated sites, distance of parcels to parks, block-group etc. Portions of this dataset are inaccessible because: Files are forthcoming. They can be accessed through the following means: Files are forthcoming. Format: Files are forthcoming
    1
    4 days ago
  • South Carolina Department of Environmental Services’ (SCDES) Ambient Water Quality Monitoring Program water chemistry data from 1999-2023. This dataset is associated with the following publication: Blocksom, K., J. Flotemersch, H. Ferriby, B. Rabon, and D. Chestnut. Intra-annual and ecoregional differences in physico-chemical data between blackwater and non-blackwater streams in the coastal plains of South Carolina. Frontiers in Water. Frontiers, Lausanne, SWITZERLAND, 7: 1540456, (2025).
    1
    4 days ago
  • There are no data to access. This manuscript describes tribal participatory research. This dataset is not publicly accessible because: there are no data. It can be accessed through the following means: There are no data. Format: no data included in manuscript. This dataset is associated with the following publication: Stover, M., D. Kusnierz, L. Melnyk, J. Lazorchak, G. Perlman, and J. Lin. Tribal-Focused Participatory Research That Accentuates Environmental Justice and Food Security Burdens Impacting the Penobscot Nation Tribal Community. ENVIRONMENTAL JUSTICE. Mary Ann Liebert, Inc., New Rochelle, NY, USA, 1-11, (2024).
    0
    4 days ago
  • Concentrations of somatic and F+ coliphage, and enterococci measured by culture and qPCR. This dataset is associated with the following publication: Kelleher, J., M. Cyterski, B. McMinn, S. Dean, A. Pemberton, J. Willis, A. Diedrich, S. McWhorter, R. Haugland, O. Shanks, and A. Korajkic. Cultured and molecular measures of fecal indicator microbes in Gulf of Mexico recreational waters. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 966: 178741, (2025).
    1
    4 days ago
  • Data related to Dye et al pub on ozone and lung pathology. This dataset is associated with the following publication: Dye, J., H. Nguyen, E. Stewart, M. Schladweiler, and C. Miller. Sex differences in impacts of early gestational and peri-adolescent ozone exposure on lung development in rats: Implications for later life disease in humans. AMERICAN JOURNAL OF PATHOLOGY. American Association of Pathologist, 194(9): 1636-1663, (2024).
    1
    4 days ago
  • Data corresponding to figures located in manuscript and appendix files. This dataset is associated with the following publication: Burdsall, A., M. Magnuson, J. Szabo, and J. Heckman. Assessment of Traditional Biosolids Disposal Methods for Biosolids Contaminated with Bacillus globigii Spores. Next Research. Elsevier B.V., Amsterdam, NETHERLANDS, 2(2): 100212, (2025).
    2
    4 days ago
  • data contain PII which cannot be released publicly. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: contact Tim Wade (wade.tim@epa.gov). Format: Data contain sensitive personally identifiable information obtained regarding medical conditions obtained from tribal nation residents. This dataset is associated with the following publication: Wade, T., J. Mistry, S. Augustine, S. Griffin, J. Kobylanski, J. Styles, E. Sams, E. Hudgens, M. Kowalcyk, W. Cochran, H. Ward, and A. Egorov. Salivary antibody responses to waterborne and environmental infections among Two Tribal Nations in the Southwest United States. JOURNAL OF INFECTIOUS DISEASES. The Journal of Infectious Diseases, 14: 1619 -1632, (2024).
    0
    4 days ago
  • Benthic cyanobacterial accumulations and associated cyanotoxins in coastal urban stormwater pond networks-2021. This dataset is associated with the following publication: Tatters, A., C. Clevenger, W. Strangman, S. Oehrle, R. Kudela, J. Aukamp, and Y. Wan. Benthic cyanobacterial accumulations and associated cyanotoxins in coastal urban stormwater pond networks. Harmful Algae. Elsevier B.V., Amsterdam, NETHERLANDS, 144: 102833, (2025).
    6
    4 days ago
  • The dataset is tabular data on DNA methylation assessment, residential history, individual-level socioeconomic status, and neighborhood built environment for participants in the Detroit Neighborhood Health Study. This dataset is not publicly accessible because: The data was not generated by the EPA, is not owned by the EPA, and contains protected information such as residential history. It can be accessed through the following means: The data can be accessed by contacting the data manager - Dr. Chantel Martin. Format: The data is tabular data containing information on DNA methylation, residential history, disease diagnoses, built environment, and individual-level socioeconomic data. This dataset is associated with the following publication: Ward-Caviness, C., S. Pu, C. Martin, S. Galea, M. Uddin, D. Wildman, K. Koenen, and A. Aiello. Epigenetic predictors of all-cause mortality are associated with objective measures of neighborhood disadvantage in an urban population. Clinical Epigenetics. BioMed Central Ltd, London, UK, 12(44): 1, (2020).
    0
    4 days ago
  • Data is tabular data containing information on 'omics (DNA methylation), residential history, serum metals, and individual-level economic and demographic information. This dataset is not publicly accessible because: The data is not owned by the EPA and contains protected information (PII) such as residential history. It can be accessed through the following means: The data can be accessed by contacting Dr. Chantel Martin. Format: Data is tabular data containing information on 'omics (DNA methylation), residential history, serum metals, and individual-level economic and demographic information. This dataset is associated with the following publication: Lodge, E., R. Dhingra, C. Martin, R.C. Fry, A. White, C. Ward-Caviness, A.H. Wani, M. Uddin, D.E. Wildman, S. Galea, and A. Aiello. Serum lead, mercury, manganese, and copper and DNA methylation age among adults in Detroit, Michigan. Environmental Epigenetics. Oxford University Press, Cary, NC, USA, 8(1): dvac018, (2022).
    0
    4 days ago
  • Data is tabular data containing metabolite concentrations, cardiovascular disease biomarkers, individual-level demographics, medication usage, and behavioral confounders (physical activity, smoking, alcohol usage). This dataset is not publicly accessible because: This data is not owned by the EPA. It can be accessed through the following means: The data can be accessed by contacting the lead study author - Susanne Rospleszcz. Format: Data is tabular data containing metabolite concentrations, cardiovascular disease biomarkers, individual-level demographics, medication usage, and behavioral confounders (physical activity, smoking, alcohol usage). This dataset is associated with the following publication: Maushagen, J., N. Addine, C. Schuppert, C. Ward-Caviness, J. Nattenmueller, J. Adamski, A. Peters, F. Bamberg, C. Schlett, R. Wang-Sattler, and S. Rospleszcz. Serum metabolite signatures of cardiac function and morphology in individuals from a population-based cohort. Biomarker Research. BioMed Central Ltd, London, UK, 12(31): s40364-024-00578-w, (2024).
    0
    4 days ago
  • Data consist of CMS Medicare data files which are restricted access and cannot be released publicly. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. EPA cannot release CBI, or data protected by copyright, patent, or otherwise subject to trade secret restrictions. Request for access to CBI data may be directed to the dataset owner by an authorized person by contacting the party listed. It can be accessed through the following means: CMS Medicare data are available from: https://www.cms.gov/data-research/files-for-order/data-disclosures-and-data-use-agreements-duas/limited-data-set-lds with the requirement of a signed Data Use Agreement. . Weather data are available at https://prism.oregonstate.edu/. Format: The data that support the findings of this study are available from the Centers for Medicare and Medicaid Services (CMS). Restrictions apply to the availability of these data, which were provided under a Data Use Agreement specific to this study. Data are available from: https://www.cms.gov/data-research/files-for-order/data-disclosures-and-data-use-agreements-duas/limited-data-set-lds with the requirement of a signed Data Use Agreement. Data do not contain personally identifiable information but contain are classified as Limited Data Set files and their distribution require an agreement and between CMS and the requester and approval by CMS. Weather data are available at https://prism.oregonstate.edu/. Because the data do not contain identifiable private information and were not obtained through interaction or intervention with individuals, the Institutional Review Board for the University of North Carolina and the US Environmental Protection Agency Human Research Protocol Officer determined that use of this data does not constitute human subjects research. This dataset is associated with the following publication: Wade, T., and C. Herbert. Weather conditions and legionellosis: a nationwide case-crossover study among Medicare recipients. EPIDEMIOLOGY AND INFECTION. Cambridge University Press, Cambridge, UK, 152: E125, (2024).
    0
    4 days ago
  • Vegetation, soil, and greenhouse gas data collected between 2019 - 2022 from control and restored southern RI coastal marshes
    1
    4 days ago
  • This dataset includes TIMES model files associated with generating scenarios for the paper (https://iopscience.iop.org/article/10.1088/2753-3751/ad958b). The study utilized US EPA's TIMES database version: EPAUS9rT_v20.4. The other file includes underlying data used for figures in the manuscript (FigureData_formatted.xlsx). This dataset is associated with the following publication: Zalesak, A., N. Kittner, D. Loughlin, and P. Kaplanakman. Evaluation of energy, carbon dioxide, and air emission implications of medium- and heavy-duty truck electrification in the United States using EPA’s regional TIMES energy systems model. Environmental Research: Energy. IOP Publishing, BRISTOL, UK, 1: 045018, (2024).
    2
    4 days ago
  • National Aquatic Resource Surveys wetland data and accretion rates and carbon stocks in Oregon tidal marshes. This dataset is associated with the following publication: Janousek, C., J. Krause, J. Drexler, K. Buffington, K. Poppe, E. Peck, F. Adame, E. Watson, J. Holmquist, S. Bridgham, S. Jones, M. Ward, C. Brown, L. Schile-Beers, M. Costa, H. Diefenderfer, A. Borde, L. Sheehan, J. Rybczyk, C. Prentice, A. Gray, A. Hinojosa-Corona, A.C. Ruiz-Fernandez, J.A. Sanchez-Cabeza, K. Kohfeld, P. Ezcurra, J. Ochoa-Gomez, K. Thorne, M. Pellatt, A. Ricart, A. Nahlik, L. Brophy, R. Ambrose, M. Lutz, C. Cornu, S. Crooks, L. Windham-Myers, M. Hessing-Lewis, F. Short, S. Chastain, T. Williams, T. Douglas, E. Fard, L. Brown, and M. Goman. Blue Carbon Stocks Along the Pacific Coast of North America Are Mainly Driven by Local Rather Than Regional Factors. Global Biogeochemical Cycles. American Geophysical Union, Washington, DC, USA, 39(3): e2024GB008239, (2025).
    2
    4 days ago
  • Results from toxicity assays using emission data during 3D prining process. This dataset is associated with the following publication: Beard, J.M., B.M. Royer, J.M. Hesita, P. Byrley, A. Lewis, J. Hadynski, J. Matheson, S.R. Al-Abed, and C.M. Sayes. Lung cell toxicological effects of 3D printer aerosolized filament byproducts. ENVIRONMENTAL SCIENCE AND POLLUTION RESEARCH. Ecomed Verlagsgesellschaft AG, Landsberg, GERMANY, 32: 5078-5090, (2025).
    1
    4 days ago
  • The dataset contains the data that was used to generate the tables and figures in the publication of the same name. This dataset is associated with the following publication: Wade, A.M., C.S. Eckley, M. Noerpel, J. Goetz, D. Leptich, K. Prestbo, D. Van de Riet, S. Sluka, R. Wilkin, and T.P. Luxton. Mobilization of porewater Pb and Zn in response to seasonal wetting and drying within contaminated floodplains. SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 958: 178053, (2025).
    1
    4 days ago
  • The file "Read-ME data & P-graph instructions 03-12-24 .docx" describes the step-by-step process to collect Information (for new models), prepare functional units/operations (for new models), modify existing model, use the P-Graph software, verify process units and flow values, extract supply chain structural solutions, and perform cost assessments to each structural solution. The file "File_plastics_2901_JP.zip" contains the P-Graph software file "File_plastics_2901_JP.pgsx" to generate all feasible plastic end-of-life supply chain structural solutions for the case study as shown in Figure 6. Figure 7 depicts selected cost-effective pathways derived from the P-graph model with the (a) lowest (647,303 EUR/y) and (b) highest (698,440 EUR/y) annualized costs. The file "Cost Calculation- Operational Capacity -1801.xlsx" has all cost parameters, equipment specifications, and location information needed to run the P-Graph plastic end-of-life supply chain case study. The file "Figure 8 - Datapoints_results_of_File_plastics_2901_JP_pgsx.xlsx" contains all total recycling costs for the most cost-effective 100 solutions generated by the P-graph model shown in Figure 8. Figures 1 and 5 can be obtained from the cited public domain repositories. This dataset is associated with the following publication: Kumar, B., J. Pimentel, N.A. Cano-Londono, G.J. Ruiz-Mercado, C.T. Deak, and H. Cabezas. Designing cost-effective supply chains for plastics at the end-of-life. JOURNAL OF CLEANER PRODUCTION. Elsevier Science Ltd, New York, NY, USA, 501: 145227, (2025).
    4
    4 days ago
  • Metadata Entry for "A population ecology- quantitative microbial risk assessment (QMRA) model for antibiotic-susceptible and antibiotic-resistant E. coli health risk in recreational water". Please contact the corresponding author to request the associated data. This dataset is not publicly accessible because: The data is non-EPA generated. It can be accessed through the following means: Please contact the corresponding author Kerry Hamilton at kerry.hamilton@asu.edu to request the data. Format: XLSX and/or CSV files. This dataset is associated with the following publication: Heida, A., M. Hamilton, J. Gambino, K. Sanderson, M. Schoen, M. Jahne, J. Garland, L. Ramirez, H. Quon, A. Lopatkin, and K. Hamilton. Population Ecology-Quantitative Microbial Risk Assessment (QMRA)Model for Antibiotic-Resistant and Susceptible E. coli in Recreational Water. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 59(9): 4266-4281, (2025).
    0
    4 days ago
  • EPA generated data for Lech et al. publication in Appl Environ Microbiol titled, "Oil Spill Surface Washing Agents and Chemical Herders Drive Microbial Community Structure Impacting Biodegradation"
    2
    4 days ago
  • Benthic macroinvertebrate occurrence data and physiochemical variables were retrieved from the 2018-2019 National Rivers and Stream Assessment (https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys) Benthic macroinvertebrate data can be downloaded as .csv file from NRSA 1819 Benthic Macroinvertebrate Count - Data (CSV) (csv). Physiochemical data can be downloaded as .csv files from NRSA 1819 Water Chemistry_CHLA - Data (CSV) (csv) and NRSA 1819 Physical Habitat Larger Set of Metrics - Data (CSV) (csv) Landscape variables were retrieved from https://www.epa.gov/national-aquatic-resource-surveys/streamcat-metrics-and-definitions and PRISM Climate Group https://prism.oregonstate.edu/
    2
    4 days ago
  • Interview transcripts. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: It is stored on the O drive- PRIV -IRBData - MaxwellDWDM. Format: IRB human subjects research data. This dataset is associated with the following publication: Matsler, A.M., K. Maxwell, and S. Henson. ‘Discarding well’ after disasters? Examination of disaster waste and debris management in the United States. Human Organization. Society for Applied Anthropology, Oklahoma City, OK, USA, 4(2): 133-144, (2025).
    0
    4 days ago
  • This is data set of meso-fauna from rain gardens, other stormwater controls and background sites. Data also include loss on ignition, bulk density and penetrometer. This dataset is associated with the following publication: Oconnor, T. Measuring soil fauna in stormwater green infrastructure. In Proceedings, International Low Impact Development Conference 2023, Cincinnati, OH, USA, 08/03/2023 - 08/03/2023. American Society of Civil Engineers (ASCE), New York, NY, USA, (2023).
    1
    4 days ago
  • The Water Quality Dataset contains field and laboratory data that were collected at a field-scale permeable reactive barrier. Environmental samples were collected from groundwater monitoring wells and surface water. This dataset is associated with the following publication: Lawrinenko, M., L. Rhea, K. Forshay, T. Lee, M. White, and R. Wilkin. Long-term field study of nitrate and ammonium remediation using a permeable reactive barrier at a livestock feeding operation. JOURNAL OF ENVIRONMENTAL MANAGEMENT. Elsevier Science Ltd, New York, NY, USA, 380: 124962, (2025).
    1
    4 days ago
  • Dissolved nitrous oxide concentrations in 984 U.S. lakes. This dataset is not publicly accessible because: It is too large to be uploaded. It can be accessed through the following means: https://github.com/USEPA/DissolvedGasNla. Format: Data files in in .csv and .rda format. Metadata are captured in script (.Rmd) files.
    0
    4 days ago
  • Dataset for "Crizer, D.M.; Rice, J.R.; Smeltz, M.G.; Lavrich, K.S.; Ravindra, K.; Wambaugh, J.F.; DeVito, M.; Wetmore, B.A. In Vitro Hepatic Clearance Evaluations of Per- and Polyfluoroalkyl Substances (PFAS) across Multiple Structural Categories. Toxics 2024, 12, 672. https://doi.org/10.3390/toxics12090672". This dataset is associated with the following publication: Crizer, D., J. Rice, M. Smeltz, K. Lavrich, K. Ravindra, J. Wambaugh, M. Devito, and B. Wetmore. In Vitro Hepatic Clearance Evaluations of Per- and Polyfluoroalkyl Substances (PFAS) Across Multiple Structural Categories. Toxics. MDPI, Basel, SWITZERLAND, 12(9): 672, (2024).
    1
    4 days ago
  • This file contains a spatial database compatible with the EPA H2O ecosystem services tool for the HUC8 watershed surrounding the town of Crisfield, MD USA. The file is publicly available on the EPA H2O model website and can be opened in the EPA H2O tool with instructions in the associated READ ME file. The database can be used in the EPA H2O tool to estimate production of ecosystem services for an user-selected Area of Interest within the watershed.
    1
    4 days ago
  • This ScienceHub entry provides Associated Data (Supplementary data 1) from the published manuscript Comput Toxicol. 2023 Jan 25;25:100261. doi: 10.1016/j.comtox.2023.100261. Further availability of data, as stated in the manuscript, will be made available on request. This dataset is associated with the following publication: Romano, J., L. Mei, J. Senn, J. Moore, and H. Mortensen. Exploring genetic influences on adverse outcome pathways using heuristic simulation and graph data science. Computational Toxicology. Elsevier B.V., Amsterdam, NETHERLANDS, 25: 100261, (2023).
    1
    4 days ago
  • This dataset contains the CMAQ STAGE hourly gridded NH3 model data provided by EPA/ORD researchers for the Makar et al. (2025) paper. The gridded data is provided in a netcdf file. This dataset is associated with the following publication: Makar, P., P. Cheung, C. Hogrefe, A. Akingunola, U. Alyuz, J. Bash, M. Bell, R. Bellasio, R. Bianconi, T. Butler, H. Cathcart, O. Clifton, A. Hodzic, I. Kioutsioukis, R. Kranenburg, A. Lupascu, J. Lynch, K. Momoh, J.L. Perez Camanyo, J. Pleim, Y. Ryu, R. San Jose, D. Schwede, T. Scheuschner, M. Shephard, R. Sokhi, and S. Galmarini. Critical load exceedances for North America and Europe using an ensemble of models and an investigation of causes of environmental impact estimate variability: an AQMEII4 study. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(5): 3049–3107, (2025).
    1
    4 days ago
  • This dataset contains the CMAQ M3Dry hourly gridded NH3 model data provided by EPA/ORD researchers for the Makar et al. (2025) paper. The gridded data is provided in a netcdf file. This dataset is associated with the following publication: Makar, P., P. Cheung, C. Hogrefe, A. Akingunola, U. Alyuz, J. Bash, M. Bell, R. Bellasio, R. Bianconi, T. Butler, H. Cathcart, O. Clifton, A. Hodzic, I. Kioutsioukis, R. Kranenburg, A. Lupascu, J. Lynch, K. Momoh, J.L. Perez Camanyo, J. Pleim, Y. Ryu, R. San Jose, D. Schwede, T. Scheuschner, M. Shephard, R. Sokhi, and S. Galmarini. Critical load exceedances for North America and Europe using an ensemble of models and an investigation of causes of environmental impact estimate variability: an AQMEII4 study. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(5): 3049–3107, (2025).
    1
    4 days ago
  • This dataset contains the CMAQ model data provided by EPA/ORD researchers for the Makar et al. (2025) paper. It includes CMAQ model data extracted at monitoring stations, CMAQ gridded annual deposition fields, and CMAQ gridded monthly median diurnal deposition diagnostics. The extracted data at monitoring stations is provided in csv text format while the gridded data is provided in netcdf files. This dataset is associated with the following publication: Makar, P., P. Cheung, C. Hogrefe, A. Akingunola, U. Alyuz, J. Bash, M. Bell, R. Bellasio, R. Bianconi, T. Butler, H. Cathcart, O. Clifton, A. Hodzic, I. Kioutsioukis, R. Kranenburg, A. Lupascu, J. Lynch, K. Momoh, J.L. Perez Camanyo, J. Pleim, Y. Ryu, R. San Jose, D. Schwede, T. Scheuschner, M. Shephard, R. Sokhi, and S. Galmarini. Critical load exceedances for North America and Europe using an ensemble of models and an investigation of causes of environmental impact estimate variability: an AQMEII4 study. Atmospheric Chemistry and Physics. Copernicus Publications, Katlenburg-Lindau, GERMANY, 25(5): 3049–3107, (2025).
    6
    4 days ago
  • Wetland accretion rates in Oregon salt marshes. This dataset is associated with the following publication: Brand, M., H. Diefenderfer, C. Cornu, M. McKeon, C. Janousek, A. Borde, T. Souza, M. Keough, C. Brown, and S. Bridgham. Can Restoring Tidal Wetlands Reduce Estuarine Nuisance Flooding of Coasts Under Future Sea-Level Rise?. Earth’s Future. John Wiley & Sons, Inc., Hoboken, NJ, USA, 13(3): e2023EF004149, (2025).
    1
    4 days ago
  • Total F Comparison Data_SciHub. This dataset is associated with the following publication: Dixit , F., E.H. Antell, K.A. Faber , C. Zhang , M.W. Pannu , M.H. Plumlee , J. Van Buren, A. Doroshow , W.C.K. Pomerantz , W.A. Arnold , C.P. Higgins , G.F. Peaslee , L.A. Cohen , D.L. Sedlak , and M. Ibrahim. Closing PFAS analytical gaps: Inter-method evaluation of total organofluorine techniques for AFFF-impacted water. JOURNAL OF HAZARDOUS MATERIALS. Elsevier Science Ltd, New York, NY, USA, 5: 100122, (2024).
    1
    4 days ago
  • Abbreviations and data for manuscript Figures in the main text and supplemental. This dataset is associated with the following publication: Stoker, T., J. Want, A. Murr, J. Bailey, and A.R. Buckalew. High-Throughput Screening of ToxCast PFAS Chemical Library for Potential Inhibitors of the Human Sodium Iodide Symporter. CHEMICAL RESEARCH IN TOXICOLOGY. American Chemical Society, Washington, DC, USA, 36(3): 380-389, (2023).
    1
    4 days ago
  • Boise Saint Luke's Meridian site EPA ORD ambient 1-minute CO, CO2, O3, NO, NO2, NOx, and NH3 data from August 1 -30, 2019 utilized in the manuscript is included along with their respective quality assurance flags. Boise Saint Luke's Meridian site Drexel University CIMS instrument formic acid, acetic acid, propionic acid, pentanoic acid, pyruvic acid, and hydrogen cyanide; and EPA ORD CO, CO2, O3, NO, NO2, NOx, and NH3 15-minute integrated data from August 14 - 30, 2019 utilized for Positive Matric Factorization (PMF) model analysis is included. Metadata tabs are provided in both data spreadsheet files describing the instruments used to generate the data and the reporting units. This dataset is associated with the following publication: Lindsay, A., B. Weesner, K. Banecker, L. Feinman, R. Long, M. Landis, and E. Wood. Noncombustion Emissions of Organic Acids at a Site near Boise, Idaho. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 1507-1705, (2024).
    2
    4 days ago
  • The data provided information on site collection such as GPS coordinates and depth for coral and water samples collected in the field. Data also provides measurement of coral tissue surface area of corals sampled for the field needed to standardize data. This dataset is associated with the following publication: Hankins, C., D. Lasseigne, S. Davis, K. Edwards, and J. Paul. Coral reef attributes associated with microplastic exposure. CORAL REEFS. Springer, New York, NY, USA, 44(1): 193-207, (2024).
    2
    4 days ago
  • The data is tabular data containing information on residential history, neighborhood built environment, individual-level economic and demographic information, and measured serum metals. This dataset is not publicly accessible because: The data is not owned by the EPA and contains protected information in the form of residential history and thus cannot be uploaded into ScienceHub. It can be accessed through the following means: The data can be accessed by contacting Dr. Chantel Martin. Format: Data is tabular data containing information on residential history, neighborhood built environment, individual-level economic and demographic information, and measured serum metals concentrations. This dataset is associated with the following publication: Lodge, E., C. Martin, R.C. Fry, A. White, C. Ward-Caviness, S. Martin, and A. Aiello. Objectively measured external building quality, Census housing vacancies and age, and serum metals in an adult cohort in Detroit, Michigan. Journal of Exposure Science and Environmental Epidemiology. Nature Publishing Group, London, UK, 177-186, (2023).
    0
    4 days ago
  • The dataset contains electronic health records from heart failure patients within information on hospital readmissions, residential location, air pollution exposure, area-level sociodemographic information, and individual-level demographics. This dataset is not publicly accessible because: The data contains electronic health records which are protected under federal law and cannot be uploaded to ScienceHub. It can be accessed through the following means: Electronic Health Records are available from UNC TRaCS and require and approved IRB application to access. Source apportioned air pollution data is available from Dr. Armistead Russell. Dr. Cavin Ward-Caviness can be reached for data access questions. Format: The data consists of tabular data from electronic health records. It contains information on readmissions, residential location, air quality exposure, area-level sociodemographic, and individual-level demographics (age, race, sex, vital status). This dataset is associated with the following publication: Walsh, A., A. Russell, A. Weaver, J. Moyer, L. Wyatt, and C. Ward-Caviness. Associations between source-apportioned PM2.5 and 30-day readmissions in heart failure patients. ENVIRONMENTAL RESEARCH. Elsevier B.V., Amsterdam, NETHERLANDS, 228: 115839, (2023).
    0
    4 days ago
  • This ScienceHub file shows the physiological data associated with the manuscript Adrenal Stress Hormone Regulation of Hepatic Homeostatic Function After an Acute Ozone Exposure in Wistar-Kyoto Male Rats published in Toxicological Sciences in 2022. These data examine how adrenalectomy modifies the response to ozone, with a specific focus on hepatic response. This dataset is associated with the following publication: Jackson, T., A. Henriquez, S. Snow , M. Schladweiler, A. Astriab Fisher, D. Alewel, J. House, and U. Kodavanti. Adrenal stress hormone regulation of hepatic homeostatic function after an acute ozone exposure in Wistar-Kyoto Male Rats. TOXICOLOGICAL SCIENCES. Society of Toxicology, RESTON, VA, 189(1): 73-90, (2022).
    1
    4 days ago
  • This Science Hub file provides access to raw data published in Environmental Health Perspectives from the publication entitled Stress Drivers of Glucose Dynamics during Ozone Exposure Measured Using Radiotelemetry in Rats. This study used implantable telemetry in rats to assess real-time changes in circulating glucose during and after exposure to ozone and mechanistically linked responses to neuroendocrine stress hormones. This dataset is associated with the following publication: Henriquez, A., S. Snow , T. Jackson, J. House, A. Motsinger-Reif, C. Ward-Caviness, M.C. Schladweiler, D. Aelwel, C. Miller, A. Farraj, M. Hazari, R. Grindstaff, D. Diaz-Sanchez, A. Ghio, and U. Kodavanti. Stress Drivers of Glucose Dynamics during Ozone Exposure Measured Using Radiotelemetry in Rats. ENVIRONMENTAL HEALTH PERSPECTIVES. National Institute of Environmental Health Sciences (NIEHS), Research Triangle Park, NC, USA, 130(2): 127006, (2022).
    1
    4 days ago
  • The data provided at the census tract scale are include in Tables 1, 2, 3, and 4 of the manuscript. Supplemental information also contains tables with summary data. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: PII associated with individual-level blood Pb data included in this analysis were obtained from Ohio Department of Health through an approved Data Use Agreement. Format: Data were imported into SAS for analysis. This dataset is associated with the following publication: Stanek, L., J. Xue, V. Zartarian Morrison, A. Poulakos, R. Tornero-Velez, E. Snyder, C. Walts, and K. Triantafillou. Identification of high lead exposure locations in Ohio at the census tract scale using a generalizable geospatial hotspot approach. ENVIRONMENT INTERNATIONAL. Elsevier B.V., Amsterdam, NETHERLANDS, 34: 718-726, (2024).
    0
    4 days ago
  • The following dataset is for the manuscript "Mineralogical controls on PFAS and anthropogenic anions in subsurface soils and aquifers." This file contains data from soil and water samples collected from South Carolina by EPA Region 4 and ORD personnel. Samples were processed and analyzed in Athens, GA EPA/ORD/CEMM/EPD/CPSB, EPA/R4/LSASD, and UGA collaborators.
    1
    4 days ago
  • This includes the ASNAT R code as of December 2025. Later versions may be updated in the public EPA github or zenodo.
    2
    4 days ago
  • Tabular data associated with the article "Ecological condition of mountain lakes in the conterminous United States and vulnerability to human development". All tabular data for lake, catchment, and watershed characteristics and population condition estimates are included. This dataset is associated with the following publication: Handler, A., M. Weber, M. Dumelle, L. Jansen, J. Carleton, B. Schaeffer, S. Paulsen, T. Barnum, A. Rea, A. Neale, and J. Compton. Ecological condition of mountain lakes in the conterminous United States and vulnerability to human development. ECOLOGICAL INDICATORS. Elsevier Science Ltd, New York, NY, USA, 173: 113402, (2025).
    8
    4 days ago
  • Datasets from Carbon Mapper portal finding there is a need for wider availability of site specific geospatial and time-resolved information (e.g., locations of gas collection wells and time-series of well downtime) to identify the methodological changes needed to better account for work face emissions in current emissions models. This dataset is associated with the following publication: Scarpelli, T.R., D.H. Cusworth, R.M. Duren, J. Kim, J. Heckler, G.P. Asner, E. Thoma, M.J. Krause, D. Heins, and S. Thorneloe. Investigating major sources of methane emissions at US landfills. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 58(49): 21545–21556, (2024).
    2
    4 days ago
  • The dataset is tabular data containing electronic health records from individuals with heart failure, a prior myocardial infarction, or represent a random sample of the UNC population. The data contains demographic data, dates of diagnoses, comorbidities, all-cause mortality dates, and proximity to major roadways (as a proxy for exposure to traffic related air pollution). This dataset is not publicly accessible because: This data contains PII in the form of electronic health records and cannot be uploaded to ScienceHub. It can be accessed through the following means: The data requires an approved IRB application to be accessed. With an approved IRB application it can be accessed by emailing ward-caviness.cavin@epa.gov. Format: The dataset is tabular data containing electronic health records from individuals with heart failure, a prior myocardial infarction, or represent a random sample of the UNC population. The data contains demographic data, dates of diagnoses, comorbidities, all-cause mortality dates, and proximity to major roadways. This dataset is associated with the following publication: Raab, H., M. Breen, A. Weaver, J. Moyer, W. Cascio, D. Diazsanchez, and C. Ward-Caviness. Comparison of associations between proximity to major roads and all-cause mortality across a spectrum of cardiovascular diseases. Environmental Epidemiology. Wolters Kluwer, Alphen aan den Rijn, NETHERLANDS, 8(6): e351, (2024).
    0
    4 days ago
  • Two datasets are included: 1) A collection of datasets (“APROBA HAWC Export 8May2024.xlsx” with accompanying glossary) obtained from study reports available on the National Toxicology Program’s (NTP’s) website (https://ntp.niehs.nih.gov/publications/reports/tr?type=Technical%20Report); and 2) the NTP dataset and datasets collected from EPA’s Toxicity Reference Database (https://github.com/USEPA/CompTox-ToxRefDB), condensed for analysis (“data-ap-ow-tr-mdl-accepted.csv” with accompanying glossary).
    4
    4 days ago
  • We conducted an unmatched case-control study of 1,225,285 infants from a North Carolina Birth Cohort (2003-2015). Ozone and PM2.5 during critical exposure periods (gestational weeks 3-8) were estimated using residential address and a national spatiotemporal model at census tract centroid. Here we describe data sources for outcome (i.e., congenital heart defects) and exposure (i.e., ozone and PM2.5) data. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: The North Carolina Birth Cohort data are not publicly available as it contains personal identifiable information. Data may be requested through the NCDHHS, Division of Public Health with proper approvals. Air pollutant concentrations for ozone and PM2.5 from the national spatiotemporal model are publicly available from EPA's website. Format: Birth certificate data from the State Center for Health Statistics of the NC Department of Health and Human Services linked with data from the Birth Defects Monitoring Program (NC BDMP) to create a birth cohort of all infants born in NC between 2003-2015. The NC BDMP is an active surveillance system that follows NC births to obtain birth defect diagnoses up to 1 year after the date of birth as well as identify infant deaths during the first year of life and include relevant information from the death certificate. A national spatiotemporal model provided data on predicted ozone PM2.5 concentrations over critical prenatal and time periods. The prediction model used data from research and regulatory monitors as well as a large (>200) array of geographic covariates to create fine scale spatial and temporal predictions. The model has a cross-validated R2 of 0.89 for PM2.5. Concentrations were predicted for daily throughout the study period at the centroid of each 2010 census tract in NC. This dataset is associated with the following publication: Arogbokun, O., T. Luben, J. Stingone, L. Engel, C. Martin, and A. Olshan. Racial disparities in maternal exposure to ambient air pollution during pregnancy and prevalence of congenital heart defects. AMERICAN JOURNAL OF EPIDEMIOLOGY. Johns Hopkins Bloomberg School of Public Health, 194(3): 709-721, (2025).
    0
    4 days ago
  • Data include assessment of pro-inflammatory cytokines, epithelial integrity, bulk RNA sequencing, and gene expression changes in human airway epithelial cells exposed to burn pit smoke condensates. This dataset is associated with the following publication: Ghosh, A., K. Rogers, S. Gallant, Y.H. Kim, J. Rager, I. Gilmour, S. Randell, and i. Jaspers. Effects of simulated smoke condensate generated from combustion of selected military burn pit contents on human airway epithelial cells. Particle and Fibre Toxicology. BioMed Central Ltd, London, UK, 21: 41, (2024).
    2
    4 days ago
  • EPA Report on Sustainable and Resilient Solid Waste Infrastructure: Onondaga County, New York Case Study. This dataset is associated with the following publication: Kaplanakman, P., K. Weitz, and S. Thorneloe-Howard. Sustainable and Resilient Solid Waste Infrastructure: Onondaga County, New York Case Study. U.S. Environmental Protection Agency, Washington, DC, USA, 2023.
    1
    4 days ago
  • This dataset contains data from the LAMARCK controlled exposure study including DNA methylation assessments done before and 24 hours after each exposure, subclinical health outcomes measures, exposure details, and demographic information on the individual participants in the study. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: The dataset can be accessed by contacting Dr. Cavin Ward-Caviness (ward-caviness.cavin@epa.gov). Format: The data is tabular data containing information on DNA methylation assessment, controlled exposure conditions, and demographics of the LAMARCK participants. DNA methylation age has also been calculated based on the DNA methylation assessment data. This dataset is associated with the following publication: Nwanaji-Enwerem, J., A. Bozack, C. Ward-Caviness, D. Diazsanchez, R. Devlin, M. Bind, and A. Cardenas. Bronchial Cell Epigenetic Aging in a Human Experimental Study of Short-term Diesel and Ozone Exposures. Environmental Epigenetics. Oxford University Press, Cary, NC, USA, 10(1): dvae017, (2024).
    0
    4 days ago
  • The dataset contains leaf area density, MARGA NH3 air concentrations, and denuder profile data. This dataset is associated with the following publication: Saylor, R., J. Walker, Z. Wu, X. Chen, D. Schwede, A.C. Oishi, and N. Lichiheb. Dynamic Ammonia Exchange within a Mixed Deciduous Forest Canopy in the Southern Appalachians. ECOLOGICAL MODELLING. Elsevier Science BV, Amsterdam, NETHERLANDS, 111007, (2025).
    1
    4 days ago
  • Concentrations and detection frequencies (DFs) of neutral PFAS with DF >50%, with the PFAS concentrations in heating and air conditioning (HAC) filters, particle-phase samples, and gas-phase samples expressed in different units for better comparison. Associated study parameters and analytical QC results. This dataset is associated with the following publication: Eichler, C., N. Chang, D. Amparo, E. Cohen-Hubal, J. Surratt, G. Morrison, and B. Turpin. Partitioning of neutral PFAS in homes and release to the outdoor environment: Results from the IPA Campaign. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 58(42): 18870–18880, (2024).
    1
    4 days ago
  • The dataset contains chromatographic retention times, CAS numbers and name of chemical compounds identified/tentatively identified in pyrolysates of tire road wear samples. Also attached are pyrolysis-GC-MS chromatograms or pyrograms obtained for the samples. This dataset is associated with the following publication: Paterson, K., B. Beckingham, G. Momplaisir, and K. Varner. Adapting Methods for Isolation and Enumeration of Microplastics to Quantify Tire Road Wear Particles with Confirmation by Pyrolysis GC–MS. ENVIRONMENTAL SCIENCE & TECHNOLOGY. American Chemical Society, Washington, DC, USA, 1769–1779, (2025).
    1
    4 days ago
  • Water RNA sequences, qPCR and water quality data. This dataset is associated with the following publication: Linz, D., I. Struewing, N. Sienkiewicz, R. Labiosa, and J. Lu. Metatranscriptomics reveals gene expression dynamics during an anatoxin-a producing Dolichospermum bloom in a western coastal lake. CHEMOSPHERE. Elsevier Science Ltd, New York, NY, USA, 372: 144124, (2025).
    1
    4 days ago
  • The data include the abundance and community compositions characterized using qPCR and metagenomic sequences. This dataset is associated with the following publication: Jeon, Y., I. Struewing, K. Clauson, N. Reetz, N. Fairchild, L. Goeres-Priest, T. Dreher, R. Labiosa, K. Carpenter, B. Rosen, E. Villegas, and J. Lu. Dominant Dolichospermum and microcystin production in Detroit Lake (Oregon, USA). Harmful Algae. Elsevier B.V., Amsterdam, NETHERLANDS, 142: 102802, (2025).
    1
    4 days ago
  • The datasets include the measurements of glucose levels in the experiment determining the glucose release rates from the HABS BLOCKS and the weekly glucose measurements in each of the mesocosms. In addition, the quantities of the cyanobacteria are given for each week of the experiment and the comparisons of the differences between the treated and control mesocosms. This dataset is associated with the following publication: Vesper, S., D. Linz, I. Struewing, and J. Lu. HABS-BLOCKS©, a floating, slow-release glucose source, promoted the growth of non-toxic heterotrophic bacteria relative to toxic cyanobacteria in lake water mesocosms. Journal of Water Resource and Protection. Scientific Research Publishing, Inc., Irvine, CA, USA, 16(12): 780, (2024).
    1
    4 days ago
  • Animation for Tolt North Fork Snow, Soil Moisture, Streamflow (mp4) Animation for Tolt River Floodplain Irradiance
    1
    4 days ago
  • These data are published in a manuscript entitled Multi-tissue transcriptomic and serum metabolomic assessment reveals systemic implications of acute ozone-induced stress response in male Wistar Kyoto rats in the journal Metabolomics. This analyses explored systemic transcriptomic and circulating metabolomic effects of inhaled ozone exposure in rats. This dataset is associated with the following publication: Jackson, T., J. House, A. Henriquez, M. Schladweiler, K.M. Jackson, A. Astriab Fisher, S. Snow , D. Alewel, A. Motsinger-Reif, and U. Kodavanti. Multi-tissue transcriptomic and serum metabolomic assessment reveals systemic implications of acute ozone-induced stress response in male Wistar Kyoto rats. Metabolomics. Plenum Press, New York, NY, USA, 19: 81, (2023).
    2
    4 days ago
  • The bacteria sequence data generated in this study is available in the Short Read Archive (SRA) of NCBI (https://www.ncbi.nlm.nih.gov/) under BioProject PRJNA509718. This dataset is associated with the following publication: Siponen, S., J. Ikonen, V. Gomez-Alvarez, A. Hokajärvi, M. Ruokolainen, B. Jayaprakash, M. Kolehmainen, I.T. Miettinen, T. Pitkänen, and E. Torvinen. Effect of Pipe Material and Disinfectant on Active Bacterial Communities in Drinking Water and Biofilms. JOURNAL OF APPLIED MICROBIOLOGY. Blackwell Publishing, Malden, MA, USA, 136(1): lxaf004, (2025).
    1
    4 days ago
  • Input data for polluted sites was downloaded from publicly available facility registries at the following links. These links contain geocoded locations for polluted sites. Toxic Release Inventory (TRI) sites: https://www.epa.gov/toxics-release-inventory-tri-program/tri-basic-data-files-calendar-years-1987-present Superfund sites: https://www.epa.gov/enviro/sems-search Landfill sites: https://deq.nc.gov/about/divisions/waste-management/solid-waste-section/solid-waste-facility-lists-presentations-and-annual-reports/solid-waste-facility-lists Auxiliary data from the Agency for Toxic Substances and Disease Registry (ATSDR) on specific contaminants: Substance Priority List (SPL) (downloaded file for all past lists): https://www.atsdr.cdc.gov/spl/resources/index.html. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: These data can be requested from the North Carolina State Center for Vital Statistics, Birth Defects Monitoring Program by experienced researchers with an approved IRB. Input data for polluted sites was downloaded from publicly available facility registries at the following links. Toxic Release Inventory (TRI) sites: https://www.epa.gov/toxics-release-inventory-tri-program/tri-basic-data-files-calendar-years-1987-present Superfund sites: https://www.epa.gov/enviro/sems-search Landfill sites: https://deq.nc.gov/about/divisions/waste-management/solid-waste-section/solid-waste-facility-lists-presentations-and-annual-reports/solid-waste-facility-lists Auxiliary data from the Agency for Toxic Substances and Disease Registry (ATSDR) on specific contaminants: Substance Priority List (SPL) (downloaded file for all past lists): https://www.atsdr.cdc.gov/spl/resources/index.html. Format: We received birth certificate records linked with birth defects monitoring program data from the NC State Center for Vital Statistics for all births in North Carolina between 2003 and 2015. These data include identifying information, including birth date and residential address, which was used to assign exposure to polluted sites. This dataset is associated with the following publication: Keeler, C., T. Luben, N. Forestieri, A. Olshan, and T. Desrosiers. Is residential proximity to polluted sites during pregnancy associated with preterm birth or low birth weight? Results from an integrated exposure database in North Carolina (2003-2015). Journal of Exposure Science and Environmental Epidemiology. Nature Publishing Group, London, UK, 33: 229-236, (2023).
    0
    4 days ago
  • Dataset includes the SRA accessions of the sequencing data used to benchmark the MetaCompare 2.0 pipeline as well as tables of bacterial taxa and antibiotic resistance genes used to perform the risk assessments. A link to the GitHub page where the pipeline source code can be found is also provided. This dataset is associated with the following publication: Rumi, M., M. Oh, B. Davis, C. Brown, J. Adeesh, P. Vikesland, A. Pruden, and L. Zhang. MetaCompare 2.0: Differential ranking of ecological and human health resistome risks. FEMS Microbiology Ecology. Oxford University Press, OXFORD, UK, 100(12): fiae155, (2024).
    2
    4 days ago
  • Lithium and co-occurring constituents from pilot- and full-scale drinking water treatment plants. This dataset is associated with the following publication: Keithley, A., P. Jordan, C. Muhlen, M. Pinelli, and D. Lytle. Lithium removal from drinking water. AWWA Water Science. John Wiley & Sons, Inc., Hoboken, NJ, USA, 7(1): e70016, (2025).
    1
    4 days ago
  • Transcript of focus groups and interviews about disaster waste and debris management. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: Contact CESER@epa.gov. Format: The dataset consists of transcripts from focus groups and interviews. This dataset is associated with the following publication: Matsler, A., and K. Maxwell. Disaster waste and debris clean-up decisions of government actors in the United States: social process and socio-material systems. Environmental Hazards. Taylor & Francis Group, London, UK, 24(1): 1-22, (2025).
    0
    4 days ago
  • The raw data consisted of demultiplexed fastq files pairs (R1.fastq and R2.fastq) per sample accessible on the NCBI Sequences Read Archive (SRA) under the BioProject accession numbers PRJNA1187555 for experiments E1 and E3 and PRJNA1187576 for E2 and E4. This dataset is associated with the following publication: Valentin, V., S. Rivera, E. Acs, S. Almeida, K. Andree, L. Apothéloz-Perret-Gentil, B. Bailet, A. Baričević, K. Beentjes, J. Bettig, A. Bouchez, C. Camilla, C. Chardon, M. Duleba, T. Elersek, C. Genthon, M. Jablonska, L. Jacas, M. Kahlert, M. Kelly, J. Macher, F. Mauri, M. Moletta-Denat, A. Mortágua, J. Pawlowski, J. Pérez-Burillo, M. Pfannkuchen, E. Pilgrim, P. Panayiota, F. Rimet, K. Stanic, K. Tapolczai, S. Theroux, R. Trobajo, B. Van der Hoorn, M. Vasquez, M. Vidal, D. Wanless, J. Warren, J. Zimmermann, and B. Paix. Proficiency testing and cross-laboratory method comparison to support standardisation of diatom DNA metabarcoding for freshwater biomonitoring. Metabarcoding and Metagenomics. Pensoft Publishers, Sofia, BULGARIA, e133264, (2025).
    2
    4 days ago
  • We used exposure data collected for a previous study of DBPs to evaluate how different sources of information impact trihalomethane (THM) exposure estimates, Specifically, we compared gestational exposure estimates to THMs based on water utility monitoring data alone, statistical imputation of daily concentrations to incorporate temporal variability, and personal water consumption and use (bathing and showering). We used Spearman correlation coefficients and ranked kappa statistics to compare exposure classifications. This dataset is not publicly accessible because: EPA cannot release personally identifiable information regarding living individuals, according to the Privacy Act and the Freedom of Information Act (FOIA). This dataset contains information about human research subjects. Because there is potential to identify individual participants and disclose personal information, either alone or in combination with other datasets, individual level data are not appropriate to post for public access. Restricted access may be granted to authorized persons by contacting the party listed. It can be accessed through the following means: Data that CDC collects or holds must be available for data sharing within a year after the data are evaluated for quality and shared with any partners in data collection activity. Because NBDPS data contain PII, NBDPS data are not released publicly. Instead, they are available via a special use agreement. Qualified researchers can be granted access to NBDPS data for analysis through collaboration with one of the Centers for Birth Defects Research and Prevention. The procedure for applying for access to NBDPS data can be found on the NBDPS Public Access Procedures web site: https://www.cdc.gov/ncbddd/birthdefects/nbdps-public-access-procedures.html. Format: This research was conducted with data collected by the CDC-sponsored National Birth Defects Prevention Study (NBDPS). These data include birth data and geocoded residential addresses before and during pregnancy. This dataset is associated with the following publication: Luben, T., R. Shaffer, E. Kenyon, W. Nembhard, K. Weber, J. Nuckols, and J. Wright. Comparison of trihalomethane exposure assessment metrics in epidemiologic analyses of reproductive and developmental outcomes. Journal of Exposure Science and Environmental Epidemiology. Nature Publishing Group, London, UK, 34: 115-125, (2024).
    0
    4 days ago
  • Analytical dataset and code used to develop the tables and figures in the manuscript entitled "Wildland fire smoke adds to disproportionate PM2.5 exposure in the United States". This dataset is associated with the following publication: Rice, R.B., J.D. Sacks, K.R. Baker, S.D. LeDuc, and J.J. West. Wildland Fire Smoke Adds to Disproportionate PM2.5 Exposure in the United States. ACS ES&T Air. American Chemical Society, Washington, DC, USA, 2(2): 215-225, (2025).
    1
    4 days ago
Share this Organization